Archive for the 'Fossils' Category

Early branches on the arthropod family tree

The Cambrian period (542 – 488 mya) is characterized by an evolutionarily rapid diversification of metazoan life forms. It is during this Cambrian explosion that most of the modern phyla, including arthropoda, first make a definitive appearance in the fossil record. The biota of this period is spectacularly preserved in the renowned Burgess Shale of British Columbia as well as other formations in China, Greenland, and Sweden.

Following the Cambrian, and near the end of the Ordovician period (488 – 443 mya), there was another relative explosion in diversity of biological forms, termed the Great Ordovician Biodiversification Event. Whereas the Cambrian explosion saw the appearance of the major modern phyla, the Great Ordovician Biodiversification Event is characterized by a diversification of life forms within those phyla, and the abrupt absence of the prototypical Cambrian forms.

Previously, the early Ordovician period was conspicuously absence from the fossil record, obscuring the fate of the Cambrian evolutionary forms. Now this gap in the fossil record has been filled with the discovery of rich marine fossil beds in southeastern Morocco. These formations show that a wondrous diversity of Cambrian forms persisted into the Ordovician and formed a connective link up to the Great Ordovician Biodiversification Event.

This new discovery is published in Nature this week, and you can read more, here.

Below are some examples of beautiful arthropod fossils from the Moroccan Ordovician formation.

Marrellomorph arthropod, a strange and poorly understood early-branching arthropod group with no living descendants. Van Roy et al., 2010.


Cheloniellid arthropod, possibly related to trilobites. Van Roy et al., 2010.


A stalked barnacle (left) and Xiphosurids (right and bottom), related to modern horseshoe crabs. Van Roy et al., 2010.

References:

  • Van Roy, P., Orr, P., Botting, J., Muir, L., Vinther, J., Lefebvre, B., Hariri, K., & Briggs, D. (2010). Ordovician faunas of Burgess Shale type Nature, 465 (7295), 215-218 DOI: 10.1038/nature09038

Science Fail: Bad sequencing ≠ Alien DNA

This is a little off topic for the blog theme, but I can’t help a little exercise in pseudoscience deconstruction (especially since it affords me an opportunity to talk a little about cool genetic tools anyone can access and use). This is one of those teachable moments, or rather, a teachable catastrophic and humiliating failure of logic and the application of the scientific method.

Lloyd Pye is an author who believes that humans did not arise via common descent form earlier organisms on earth. Rather, he supports the much more reasonable proposition that early human civilizations were planted on earth by extraterrestrials. To back this up, Mr. Pye thinks he has found the skull of either an alien, or a human-alien hybrid (for now, lets ignore the complete absurdity of hybridizing two organisms with completely unconnected evolutionary pasts).

The 'Starchild' skull: Obviously an alien hybrid and not a deformed human.

The ‘Starchild’ skull was allegedly found in a cave in Mexico 70 years ago. Carbon dating puts it at about 900 years since the individual’s death. DNA testing of the skull by forensic laboratories found an X and Y chromosome, indicating that it belonged to human male from two human parents. In addition, mitochondrial DNA sequencing by another professional laboratory showed that the skull was of Native American ancestry. The skull is likely that of a human child afflicted with hydrocephaly; caused by fluid build up in the cranium that pushes out on the skull and deforms the head as the child develops. For a longer summary of the analyses preformed on the Starchild skull check out this article by Steven Novella.

Since none of the previous scientific analysis indicated that the Starchild was an alien, Lloyd Pye dismisses it out of hand. Recently however, Mr. Pye has announced his own incontrovertible evidence that the Starchid was an alien. Let’s take a look at his evidence, which is apparently so compelling as to justify throwing out the infinitely more reasonable scientific explanations for the Starchild skull.

Are you ready?

This is truly powerful data…

Prepare to have your perceptions of the cosmos and humanity shaken to their very core….

What your’re looking at is an error screen from the BLAST genetic alignment search tool that says:

No significant similarity found. For reasons why, click here

Holy crap!!! I’ve apparently been discovering alien DNA for years! Whenever I get that error, I thought I had simply amplified and sequenced some junk DNA or a aggregation of PCR primers and random genetic material, but no, I (and molecular biologists all around the world) have been discovering countless aliens over the years!

*fiszzzzzit-poof*

Oops! Looks like my sarcasm circuit finally melted down. I’ll guess I’ll explain how blast works and how you can end up looking at the error screen above.

BLAST is an extremely useful tool that allows you to search the entire GenBank database (a NIH administrated depository for genetic sequencing data) based on a query DNA or protein sequence. If you isolate and sequence a new gene you can throw it into BLAST, and BLAST will find, and display in order of similarity, all related sequences from GenBank. In this manner you can confirm the the identity of a gene, what type of protein it codes for, or what sort of animal it comes from.

Here, you can even try it. Suppose your sequencing reactions yield this gene fragment:

CCTGTGGTCCTACACAACATGGTGTTATTTCATGACCTTTGTCTTCATCGTCTACTGCT
ACTGGTTCATCGTAGCCGCTGTCAGAAACCACGAGAAGGCCATGAGGGAGCAGGCTAA
GAAGATGGGCGTCAAGTCCCTCCGAGGCGACGCCGACGCTCAGAAGAAGTCTGCCGA
CTGCAAGCTGGCCAAGATCGCCCTCATCAACGTGTCCCTCTGGTTCATGGCCTGGACA
CCCTACACCATGATCAACATCGCCGGATTGACTAACAAGGAAATCGTCACACCTCTCT
TCTCCATCTGGGGTTCCGTCTTGGCCAAGGCAAACACTGTCT

Copy and paste that into the first ‘Query Sequence’ text box on the BLAST page. Make sure the database is set to ‘nucleotide collection (nr/nt)’ and click the ‘BLAST’ button on the bottom. After a bit of processing it will come back with the closest gene sequences to the one you entered. You should find that the sequence is very similar to an opsin gene from the mantis shrimp, Neogonodactylus oerstedii.

Unfortunately, BLAST doesn’t always generate any matches. That could be because you are searching a subset of the full database, the search alignment stringency parameters are too restrictive, or there is something wrong with the DNA sequence you isolated. This happens all the time and is a common discrepancy in the DNA amplification and sequencing process. Here is a portion of one such sequencing result that I obtained a couple years ago when I was trying to find visual genes in a particular mantis shrimp:

ATGTATACAAATGCTGATGGAGTAATAGGAAAGAAAGAAGAGCTGGGAGACTACATTG
TGGGAA

Search this sequence in BLAST exactly as above and you too can discover alien DNA!

So, this is the new ‘stunning’ evidence that Lloyd Pye has uncovered. An unnamed ‘geneticist’ from an unnamed lab or company has amplified an undisclosed DNA gallimaufry, and thrown it into BLAST; yielding an error message that competent scientists see, and disregard, regularly. From this non-result, he makes a dumfounding leap of un-logic to conclude that the Starchild must have been an alien.

Normally, I would feel bad about picking on such an obvious quack. However, Pye makes a living selling this fraudulent Starchild BS, and he rides it into everyone’s living rooms via the unscrupulous ‘science and learning’ television networks. Pye’s Starchild website boasts:

Sadly, and embarrassingly for these networks, this is one of the few pieces of factual information that Pye presents.

Via the SGU podcast.

Treasure trove of arthropods found in Cretaceous African amber

Researchers have recently unearthed a bounty of fossil-bearing amber in Ethiopia. These 95 million year old amber pieces contain a variety of life forms including plants, fungai, bacteria, nematodes and many species of arthropods. The arthropods found in the amber include springtails, fairy wasps, thrips, Zorapterans (a species-poor Insect order that I had never heard of), and arachnids. Here are some shots of the arthropod amber inclusions.

Arthropod amber inclusions for Cretaceous Ethiopia. From left to right: A false fairy wasp (Mymarommatidae), a thrips (Merothripidae), and a Zorapteran. Adapted from Schmidt et al., 2010.

These sort of amber fossils are especially useful in piecing together the complex interplay of life in ancient ecosystems. They provide a snapshot of a wide variety of contemporary and interdependent life that other fossil types do not preserve. This find helps fill in some especially troublesome gaps in Cretaceous African biodiversity.

Read more at Wired or get the paper at PNAS; but don’t tell this guy about it:

Interesting trivia: John Hammond in 'Jurassic Park' was played by Richard Attenborough, elder brother of naturalist David Attenborough.


I have moved.
Arthropoda can now be found here.

Michael Bok is a graduate student studying the visual system of mantis shrimp.

Flickr Photos


Design a site like this with WordPress.com
Get started