% Generated by roxygen2: do not edit by hand

 % Please edit documentation in R/AllGenerics.R, R/addRestrictionEnzymes.R
 \name{addRestrictionEnzymes}
 \alias{addRestrictionEnzymes}

 \alias{addRestrictionEnzymes,GuideSet-method}
 \alias{addRestrictionEnzymes,PairedGuideSet-method}
 \alias{addRestrictionEnzymes,NULL-method}

 \title{Restriction enzyme recognition sites in spacer sequences}
 \usage{

 addRestrictionEnzymes(object, ...)
 

 \S4method{addRestrictionEnzymes}{GuideSet}(
   object,

   enzymeNames = NULL,
   patterns = NULL,
   includeDefault = TRUE,
   flanking5 = "ACCG",
   flanking3 = "GTTT"
 )
 

 \S4method{addRestrictionEnzymes}{PairedGuideSet}(
   object,
   enzymeNames = NULL,
   patterns = NULL,
   includeDefault = TRUE,
   flanking5 = "ACCG",
   flanking3 = "GTTT"
 )
 

 \S4method{addRestrictionEnzymes}{NULL}(object)

 }
 \arguments{

 \item{object}{A \linkS4class{GuideSet} or a 
 \linkS4class{PairedGuideSet} object.}
 

 \item{...}{Additional arguments, currently ignored.}
 

 \item{enzymeNames}{Character vector of enzyme names.}
 
 \item{patterns}{Optional named character vector for custom restriction site
 patterns. Vector names are treated as enzymes names. See example.}
 
 \item{includeDefault}{Should commonly-used enzymes be included?
 TRUE by default.}
 
 \item{flanking5, flanking3}{Character string indicating the 5' or 3' flanking
 sequence, respectively, of the spacer sequence in the lentivial vector.}
 }
 \value{

 Adds a DataFrame indicating

     whether cutting sites for the specified enzymes are found in the gRNA
     cassette (flanking sequences + spacer sequences).
 }
 \description{

 Add restriction site enzymes annotation.

 }
 \details{
 Restriction enzymes are often used for cloning purpose during the
     oligonucleotide synthesis of gRNA lentiviral constructs. Consequently,
     it is often necessary to avoid restriction sites of the used restriction

     enzymes in and around the spacer sequences. 
     \code{addRestrictionEnzymes} allows for

     flagging problematic spacer sequences by searching for restriction sites
     in the [flanking5][spacer][flanking3] sequence.
     
     The following enzymes are included when \code{includeDefault=TRUE}:
     EcoRI, KpnI, BsmBI, BsaI, BbsI, PacI, and MluI.
     
     Custom recognition sequences in \code{patterns} may use the IUPAC
     nucleotide code, excluding symbols indicating gaps. Avoid providing
     enzyme names in \code{patterns} that are already included by default (if
     \code{includeDefault=TRUE}) or given by \code{enzymeNames}. Patterns
     with duplicated enzyme names will be silently ignored, even if the
     recognition sequence differs. See example.
 }
 \examples{
 data(SpCas9, package="crisprBase")
 seq <- c("ATTTCCGGAGGCGAATTCGGCGGGAGGAGGAAGACCGG")
 guideSet <- findSpacers(seq, crisprNuclease=SpCas9)
 
 # Using default enzymes:
 guideSet <- addRestrictionEnzymes(guideSet)
 
 # Using custom enzymes:
 guideSet <- addRestrictionEnzymes(guideSet,
                                   patterns=c(enz1="GGTCCAA",
                                              enz2="GGTCG"))
 
 # Avoid duplicate enzyme names
 guideSet <- addRestrictionEnzymes(guideSet,
                                   patterns=c(EcoRI="GANNTC")) # ignored
 
 }
 \seealso{
 \code{\link{enzymeAnnotation}} to retrieve existing enzyme
     annotation from a \linkS4class{GuideSet} object.
 }
 \author{
 Jean-Philippe Fortin, Luke Hoberecht
 }