Showing posts with label metagenomics. Show all posts
Showing posts with label metagenomics. Show all posts

Friday, December 20, 2019

GBIF metagenomics and metacrap

Yes, this is a clickbait headline, and yes, it may seem like shooting fish in a barrel to complain about crappy data in GBIF, but my point here is raise concerns about the impact of metagenomic data on GBIF, and how difficult it may be to track down the causes of errors.

I stumbled across this example while looking for specimen records for the genus Rafflesia, which are parasitic plants famous for the spectacular size of their flowers (up to 1m across).



The GBIF map for Rafflesia shows a few outliers. Unfortunately GBIF doesn't make it easy to drill down (why oh why can't we just click on the map and see the corresponding occurrences?) so I opened the map in iSpecies and clicked on each outlier in turn. The one in Vanuatu (438164267 from the Paris museum P00577336) is identified to genus level only and has the note:
Parasite terrestre, grande fleur orange au ras du sol. Incomplète suite à prédation. Très forte odeur désagréable. Récolté par Sylvain Hugel (photo) (alcool seul)
which Google translates as:
Terrestrial parasite, large orange flower at ground level. Incomplete due to predation. Very strong unpleasant odor. Collected by Sylvain Hugel (photo) (alcohol only)
Sounds a bit like Rafflesia but there's no photo or other information available online. Likewise there's no additional data for the record from Brazil (1090499968). There is a record from Madagascar that is accompanied by a photo, but it that looks nothing like Rafflesia (1261055923):


That leaves two records, 2018528337 (Rafflesia cantleyi) from off the coast of Peru, and 2014813273 (Rafflesia) off the coast of Australia. Both of these records are metagenomic. For example, occurrence 2018528337 is part of a dataset Amplicon sequencing of Tara Oceans DNA samples corresponding to size fractions for protists that, on the face of it, would be an unlikely source of occurrences of forest dwelling plants.

What we get in the GBIF occurrence record is a link to the pipeline used to generate the data (Pipeline version 4.1 - 17-Jan-2018), the sample (ERS491947), and an analysis (MGYA00167469) that summarises all the taxonomic data from the ocean water sample.



What we don't get in GBIF is an obvious way to try and figure out why GBIF thinks that large flowers live in the ocean. I followed the links from MGYA00167469 and downloaded a bunch of files, some in familiar formats (FASTA), others in formats I'd not seen before (e.g., HDF5). From the mapseq file we have the following line:

ERR562574.2494029-BISMUTH-0000:2:112:3465:9749-2/89-1 GFBU01000011.4303.6106 76 0.9634146094322205 79 3 0 6 88 1722 1804 +  sk__Eukaryota;k__Viridiplantae;p__Streptophyta;c__;o__Malpighiales;f__Rafflesiaceae;g__Rafflesia;s__Rafflesia_cantleyi 

This tells us that sequence ERR562574.2494029-BISMUTH-0000:2:112:3465:9749-2/89-1 matches GenBank sequence GFBU01000011, which is "Rafflesia cantleyi RC_11 transcribed RNA sequence" from a paper on flower development in Rafflesia cantleyi doi:10.1371/journal.pone.0167958. So, now we see why we think we have giant flowers off the coast of Peru.

The rest of the line has information on the match: the oceanic sequence has a 0.96 identity with the plant sequence, has 79 matches, 3 mismatches, and no gaps, which suggests that this is a short sequence. Going digging in the FASTA file I found the raw sequence, and it is indeed very short:

>ERR562574.2494029-BISMUTH-0000:2:112:3465:9749-2/89-1
GTCTAAGTGTCGTGAGAAGTTCGTTGAACCTGATCATTTAGAGGAAGTAGAAGTCGTAAC
AAGGTTTCCGTAGGTGAACCTGCGGAAGG


This short string is the evidence for Rafflesia in the ocean. Out of curiosity I ran this sequence through BLAST:

Query  1     GTCTAAGTGTCGTGAGAAGTTCGTTGAACCTGATCATTTAGAGGAAGTAGAAGTCGTAAC  60
             |||||||||||||| |||||||||||||||| ||||||||||||||| ||||||||||||
Sbjct  1683  GTCTAAGTGTCGTGGGAAGTTCGTTGAACCTTATCATTTAGAGGAAGGAGAAGTCGTAAC  1742

Query  61    AAGGTTTCCGTAGGTGAACCTGCGGAAGG  89
             |||||||||||||||||||||||||||||
Sbjct  1743  AAGGTTTCCGTAGGTGAACCTGCGGAAGG  1771

The top hit is Bathycoccus prasinos, a picoplanktonic alga with a world-wide distribution. This seems like a more plausible identification for this sequence (all the top 100 hits are very similar to each other, many are labelled as Bathycoccus).



So, there's something clearly amiss with the analysis of this dataset. Someone who knows more about metagenomics than I do will be better placed to explain why this pipeline got it so wrong, and how common this issue is.

Given the scale and automation of metagenomics, there will always be errors - that is inevitable. What we need is ways to catch those errors, especially ones that are going to "pollute" existing distribution data with spurious records (flowers in the ocean). And in a sense, GBIF excels at this in that it exposes data to a wider audience. If you work on marine microbiology you might not notice that your sequences apparently include forest plants, but if you work on forest plants you will almost certainly notice sequences occurring in the ocean.

A key feature of GBIF that makes it so useful is that, unlike many data repositories, it does not treat data as a "black box". GBIF is not like a library catalogue which merely tells you that they have books and where to find them, instead it is like Google Books, which can tell you which books contain a given phrase you are looking for. By opening up each dataset and indexing the contents, GBIF enables us to do data analysis (in much the same way that GenBank isn't just a catalogue of sequences, it enables you to search the sequences themselves).

This is a feature we risk losing if we treat metagenomics data as a black box. The Tara Oceans data that GBIF receives is simply a list of taxa at a locality, it's a checklist. We have to take it on trust that the taxonomic assignments are accurate, and it is not a trivial task to diagnose errors. Compare this to having the photo that accompanied the record from Madagascar, which helps us determine that the identification is wrong. Going forward, it would be helpful if we had metagenomic sequences available as part of the data download from GBIF. It's also worth considering whether GBIF should start doing its own analysis of sequence data, or asking its contributors to check that their taxonomic assignments are correct (e.g., running BLAST on the data). Otherwise GBIF users may end up having to filter their data for a growing number of completely spurious records.

Update

Looks like (occurrence 1261055923) is Langsdorffia:


Wednesday, December 17, 2014

Is DNA barcoding dead?

On a recent trip to the Natural History Museum, London, the subject of DNA barcoding came up, and I got the clear impression that people at the NHM thought classical DNA barcoding was pretty much irrelevant, given recent developments in sequencing technology. For example, why sequence just COI when you can use shotgun sequencing to get the whole mitogenome? I was a little taken aback, although this is a view that's getting some traction, e.g. [1,2]. There is also the more radical view that focussing on phylogenetics is itself less useful than, say, "evolutionary gene networks" based on massive sequencing of multiple markers [3].

At the risk of seeming old-fashioned in liking DNA barcoding, I think there's a bigger issue at stake (see also [4]). DNA barcoding isn't simply a case of using a single, short marker to identify animal species. It's the fact that it's a globalised, standardised approach that makes it so powerful. In the wonderful book "A Vast Machine" [5], Paul Edwards talks about "global data" and "making data global". The idea is that not only do we want data that is global in coverage ("global data"), but we want data that can be integrated ("making data global"). In other words, not only do we want data from everywhere in the world, say, we also need an agreed coordinate system (e.g., latitude and longitude) in order to put each data item in a global context. DNA barcoding makes data global by standardising what a barcode is (a given fragment of COI), and what metadata needs to be associated with a sequence to be a barcode (e.g., latitude and longitude) (see, e.g. Guest post: response to "Putting GenBank Data on the Map"). By insisting on this standardisation, we potentially sacrifice the kinds of cool things that can be done with metagenomics, but the tradeoff is that we can do things like put a million barcodes on a map:

Bold
To regard barcoding as dead or outdated we'd need an equivalent effort to make metagenomic sequences of animals global in the same way that DNA barcoding is. Now, it may well be that the economics of sequencing is such that it is just as cheap to shotgun sequence mitogenomes, say, as to extract single markers such as COI. If that's the case, and we can get a standardised suite of markers across all taxa, and we can do this across museum collections (like Hebert et al.'s [6] DNA barcoding "blitz" of 41,650 specimens in a butterfly collection), then I'm all for it. But it's not clear to me that this is the case.

This also leaves aside the issue of standardising other things's much as the metadata. For instance, Dowton et al. [2] state that "recent developments make a barcoding approach that utilizes a single locus outdated" (see Collins and Cruickshank [4] for a response). Dowton et al. make use of data they published earlier [7,8]. Out of curiosity I looked at some of these sequences in GenBank, such as JN964715. This is a COI sequence, in other words, a classical DNA barcode. Unfortunately, it lacks a latitude and longitude. By leaving off latitude and longitude (despite the authors having this information, as it is in the supplemental material for [7]) the authors have missed an opportunity to make their data global.

For me the take home message here is that whether you think DNA barcoding is outdated depends in part what your goal is. Clearly barcoding as a sequencing technology has been superseded by more recent developments. But to dismiss it on those grounds is to miss the bigger picture of what is a stake, namely the chance to have comparable data for millions of samples across the globe.

References

  1. TAYLOR, H. R., & HARRIS, W. E. (2012, February 22). An emergent science on the brink of irrelevance: a review of the past 8 years of DNA barcoding. Molecular Ecology Resources. Wiley-Blackwell. doi:10.1111/j.1755-0998.2012.03119.x
  2. Dowton, M., Meiklejohn, K., Cameron, S. L., & Wallman, J. (2014, March 28). A Preliminary Framework for DNA Barcoding, Incorporating the Multispecies Coalescent. Systematic Biology. Oxford University Press (OUP). doi:10.1093/sysbio/syu028
  3. Bittner, L., Halary, S., Payri, C., Cruaud, C., de Reviers, B., Lopez, P., & Bapteste, E. (2010). Some considerations for analyzing biodiversity using integrative metagenomics and gene networks. Biol Direct. Springer Science + Business Media. doi:10.1186/1745-6150-5-47
  4. Collins, R. A., & Cruickshank, R. H. (2014, August 12). Known Knowns, Known Unknowns, Unknown Unknowns and Unknown Knowns in DNA Barcoding: A Comment on Dowton et al. Systematic Biology. Oxford University Press (OUP). doi:10.1093/sysbio/syu060
  5. Edwards, Paul N. A Vast Machine: Computer Models, Climate Data, and the Politics of Global Warming. MIT Press ISBN: 9780262013925
  6. Hebert, P. D. N., deWaard, J. R., Zakharov, E. V., Prosser, S. W. J., Sones, J. E., McKeown, J. T. A., Mantle, B., et al. (2013, July 10). A DNA “Barcode Blitz”: Rapid Digitization and Sequencing of a Natural History Collection. (S.-O. Kolokotronis, Ed.)PLoS ONE. Public Library of Science (PLoS). doi:10.1371/journal.pone.0068535
  7. Meiklejohn, K. A., Wallman, J. F., Pape, T., Cameron, S. L., & Dowton, M. (2013, October). Utility of COI, CAD and morphological data for resolving relationships within the genus Sarcophaga (sensu lato) (Diptera: Sarcophagidae): A preliminary study. Molecular Phylogenetics and Evolution. Elsevier BV. doi:10.1016/j.ympev.2013.04.034
  8. Meiklejohn, K. A., Wallman, J. F., Cameron, S. L., & Dowton, M. (2012). Comprehensive evaluation of DNA barcoding for the molecular species identification of forensically important Australian Sarcophagidae (Diptera). Invertebrate Systematics. CSIRO Publishing. doi:10.1071/is12008