Sequence of synthetic oligonucleotide primers used to characterization of
1. Introduction
Colonization with
Molecular techniques have revealed that
In Brazil, it is estimated that only about 10 to 15% of the gastric cancer cases are diagnosed at an early stage, aspect that directly impact the prognosis of the disease, which presents low survival rates. Unlike patients with advanced gastric cancer, that ones diagnosed at the early stage of the disease present an excellent prognostic, in which a five-year survival rate is more than 90%.
Many early gastric cancers are believed to go through a life cycle consisting of ulcerations, followed by healing, then reulceration, and some tumors remain at this early stage for years even without treatment. Nevertheless, some of these tumors rapidly advanced, perhaps one of the principal questions concerning the gastric carcinogenesis.
Consequently, some questions can be considered about it. Is the
The principal aim of our book chapter is to identify the genetic characteristics of
2. Helicobacter pylori
2.1. General characteristics
Gastric colonization with
The routes of transmission of
In addition, in the last years,
2.2. Virulence factors of H. Pylori
Urease is an important enzyme which is produced by
VacA is a cytotoxin secreted from
The cagPAI is a 40kb region of chromosomal DNA encoding approximately 31 genes that forms a type IV secretion system that forms a pilus that delivers CagA, an oncoprotein, into the cytosol of gastric epithelial cells through a rigid needle structure covered by CagY, a VirB10-homologous protein and CagT, a VirB7-homologous protein, at the base [37,38]. cagA is a polymorphic gene that presents different numbers of repeat sequences located in its 3´region and each repeat region of the CagA protein contains Glu-Pro-IIe-Tyr-Ala (EPIYA) motifs, including a tyrosine phosphorylation site [39]. Upon delivery into host cells, CagA undergoes Src-dependent tyrosine phosphorylation and activates an eukaryotic phosphatase (SHP-2), leading to dephosphorylation of host cell proteins and cellular morphologic changes [40]. CagA has also been shown to dysregulate β-catenin signaling [41] and apical-junctional complexes [42], events that have been linked to increased cell motility and oncogenic transformation in a variety of models [43]. In addition, some studies have been reported that the cagPAI appears to be involved in the induction of gastric interleukin-8 (IL-8) production, a potent neutrophil-activating chemokine [44]. Consequently, the presence of the cagA gene has been associated with higher grades of inflammation, which may lead to the development of the most severe gastrointestinal diseases, such as peptic ulcer disease and gastric cancer [45-48].
3. Gastric cancer
3.1. Epidemiology
Cancer is a worldwide full-scale problem as it will affect one in three men and one in four women during their lifetime [58]. Nowadays, this disease represents one in eight deaths around the world. The global cancer rate has doubled in the last 30 years of the 20th century, and will almost triple by 2030, a year in which it is foreseen that 20.3 million people will be diagnosed cancer and 13.2 million will die as a result of this disease [59].
World Health Organization estimates that 43% of cancer deaths are due tobacco, diet and infection. One-fifth of cancers worldwide are due to chronic infections, mainly from hepatitis viruses (liver), papillomaviruses (cervix),
Gastric cancer continues to be a major global health problem [61] and, despite the decreasing incidence and mortality rates observed worldwide over the last 50 years, it still ranks as a leading cause of cancer-related deaths in many parts of the world [62]. As symptoms are often absent or nonspecific in patients with the early stages of the disease, gastric cancer is usually diagnosed in an advanced stage, when curative options are limited. With exceptions in countries that have developed screening programs for early diagnoses, as example Japan, most patients reach treatment with cancers already in advanced stages [63]. Consequently, gastric cancer carries a poor prognosis, with an overall five-year survival rate of less than 20% [64].
Besides, one study assessed the survival of gastric cancer in population-based registries obtained in cities from four continents and concluded that the large differences observed among these areas were exclusively due to the different types of stomach cancer, highlighting the importance of the stage of the disease as an indicator of the effect of delayed diagnosis on the prognosis of these patients [65].
In Brazil, in 2005, the highest incidence rates, adjusted by age, were found in São Paulo (male, 38,8/100.000; female, 15,0/100.000) and the Federal District (male, 32,7/100.000; female 14,7/100.000) [66]. The National Institute of Cancer in Brazil estimates that, in 2014, there will occur 580.000 new cases of cancer. The most frequent cancers in Brazilian population will be non-melanoma skin (182.000), prostate (69.000), breast (57.000), colon and rectum (33.000), lung (27.000) and stomach (20.000). Considering Brazilian regions and gender, gastric cancer will be the fourth most common cancer in Brazil. In male gender, it is the second most common tumour in the North (11/100.000 cases) and Northeast (10/100.000 cases) regions; it is the fourth most common tumour in the Midwest (11/100.000 cases) and in the South (16/100.000) regions and the fifth most common in the Southeast region (15/100.000 cases). Concerning the female gender, gastric cancer is the fifth most common cancer in Brazil, the third most frequent in the North region (6/100.000 cases), and the fifth most frequent in the Northeast (6/100.000 cases) and Southeast (8/100.000 cases) regions [67].
The chances of surviving the onset of some common cancers depend largely on how early they are detected and how well they are treated. Early detection is based on the observation that treatment is more effective when cancer is detected early. It includes awareness of early signs and symptoms of cancer and screening, which is the mass testing of people who appear to be healthy. In many developing countries, where these are not feasible, several other low technology approaches are being studied and look promising. The success of public health programmes in detecting cancer early depends on the allocation of resources, availability of qualified specialists and access to follow-up treatment [60].
3.2. Classification of gastric cancer
The vast majority of gastric cancers are adenocarcinomas. Two histologically distinct variants of gastric adenocarcinoma have been described, each with different pathophysiological features: the diffuse type and the intestinal type [68], which corresponds, respectively, to the undifferentiated or poorly-differentiated type and to the well-differentiated type, in the Japanese classification [69].
Diffuse type gastric adenocarcinoma is often associated with familial distribution and more commonly affects younger people. It consists of individually infiltrating neoplastic cells that do not form glandular structures and arises closer to the advancing border of inflammation but without any identifiable histological precursor lesion [62,70,71].
Gastric adenocarcinoma of the intestinal type is preceded by a prolonged precancerous process. In 1975, Correa and colleagues proposed a model of gastric carcinogenesis, postulating that the intestinal type of gastric cancer was the end result of progressive changes in the gastric mucosa, starting with chronic gastritis, followed by multifocal atrophic gastritis and intestinal metaplasia [72]. This model was updated in 1988 and 1992 [73,74] and the following steps were recognized: normal gastric mucosa → superficial gastritis (later renamed non-atrophic gastritis) → multifocal atrophic gastritis without intestinal metaplasia → intestinal metaplasia of the complete (small intestine) type → intestinal metaplasia of the incomplete (colonic) type → low-grade dysplasia (low-grade noninvasive dysplasia) → high-grade dysplasia (high-grade noninvasive dysplasia) → invasive adenocarcinoma [75]. These lesions are well-characterized histopathologically and represent a continuum of changes depicting multiple events that increase in intensity and extension with time [76].
Both diffuse and intestinal types are associated with
3.3. Helicobacter pylori and gastric cancer — The precancerous cascade
Exposure of gastric epithelial cells to
Specifically regarding to intestinal type gastric adenocarcinoma, evidence that
As explained before, Correa and colleagues (1975) proposed a model of gastric carcinogenesis, considering that the intestinal type gastric cancer probably is the result of histological continuum changes that occur especially due to
3.3.1. Chronic active non-atrophic gastritis
Gastritis is characterized by increased infiltration of the lamina propria with mononuclear leukocytes (chronic inflammation) and polymorphonuclear neutrophils (acute inflammation). Additionally, scattered eosinophils and mast cells can be observed. The gastritis is called “active” when polymorphonuclear neutrophils are found, representing acute inflammation. This phase of the precancerous process does not show loss of glands (atrophy) and is called “nonatrophic gastritis” in the updated Sydney classification of gastritis, adopted by most pathologists (Figure 1) [84].
The most frequent cause of gastritis is

Figure 1.
Chronic gastritis
3.3.2. Multifocal atrophic gastritis
Loss of normal glandular tissue is the first specific recognizable step in the precancerous cascade. Usually it is the result of a prolonged inflammatory process and tends to be multifocal, giving rise to the so-called multifocal atrophic gastritis (Figure 2). The foci of atrophy are present in the mucosa of gastric antrum and body, and their extension progresses with time [75]. More virulent bacterial strains and a permissive host immune response are strongly associated with atrophy and progression to severe disease [84].

Figure 2.
Atrophic gastritis
3.3.3. Intestinal metaplasia
At this stage of the gastric precancerous process, the original glands and the foveolar epithelium are replaced by cells with intestinal phenotype [84]. Intestinal metaplasia (Figure 3) is considered to be an advanced stage of atrophy because the metaplastic glands replace the original glands and chronologically the metaplastic glands appear after the gastric glands are lost. Intestinal metaplasia has been classified on the basis of morphology and enzyme histochemistry in two main types: the small intestine or complete type, and the colonic or incomplete type [75].
Up to this point in the cascade, the epithelium in the atrophic and metaplastic lesions remains well differentiated, with normal nuclear-cytoplasmic ratio, normal nuclear morphology, and normal tissue architecture. The dynamics of the precancerous process to this point shows a gradual phenotypic transformation from normal epithelium to metaplastic cells with small intestinal morphology and then to cells resembling colonic mucosa, additionally expressing gastric and colonic mucins. This process usually takes decades and is progressive, supporting the notion that although environmental alterations (bacterial factors and cytokine environment, loss of cell signaling) may have initially driven differentiation decisions, with time, permanent changes in the stem cell compartment have occurred. In some patients with incomplete metaplasia, a mild degree of nuclear atypia and architectural distortion is observed, leading some investigators to consider incomplete metaplasia as a mild form of dysplasia [84,85].

Figure 3.
Intestinal metaplasia (antrum)
3.3.4. Dysplasia
Also called intraepithelial neoplasia or noninvasive neoplasia, dysplasia is characterized by a neoplastic phenotype, both in terms of cell morphology and architectural organization [75]. The nuclei of the dysplastic epithelium are enlarged, hyperchromatic, irregular in shape, and devoid of polarity [84]. The Padova classification is focused on gastric dysplasia and was developed by an international group of experienced gastrointestinal pathologists and recognizes five categories of lesions, utilizing mostly western nomenclature and grouping them numerically following the prevailing Japanese system: 1. negative for dysplasia; 2. indefinite for dysplasia; 3. noninvasive neoplasia (sub-classified in low grade or high grade); 4. suspicious for invasive carcinoma; and 5. invasive carcinoma [86].
The management of low-grade dysplasia is not well defined and there is a recommendation of annual endoscopic monitoring with rebiopsy [87]. Nevertheless, patients with high-grade dysplasia confirmed at least two gastrointestinal pathologists should undergo surgical or endoscopic resection because of the high probability of coexisting or metachronous invasive carcinoma [88].
3.3.5. Invasive adenocarcinoma
Invasive adenocarcinoma is the next stage in the cascade and requires the penetration of neoplastic cells into the surrounding stroma (Figure 4). Recent evidence suggests that this step demands that neoplastic cells acquire the capability of degrading the stromal matrix surrounding the neoplastic cells [75.

Figure 4.
Gastric adenocarcinoma
3.4. Early and advanced lesions
Follow-up of patients with precursor lesions in populations at high gastric cancer risk has thrown light on the dynamics of the process. The progression of the precursor lesions described before follows a pattern of steady state, with episodes of progression to more advanced lesions and episodes of regression to less advanced lesions.
Unlike patients with advanced gastric cancer, patients diagnosed in an early stage of the disease present an excellent prognostic, in which a five-year survival rate is more than 90%. Early gastric cancer lesions are defined as the adenocarcinoma that is confined to the mucosa or submucosa, irrespective of lymphonode invasion (Figure 5). Many early gastric cancers are believed to go through a life cycle consisting of ulcerations, followed by healing, then reulceration, and some lesions remain at this early stage for years even without treatment [89]. Nevertheless, some early tumours rapidly became advanced and it is one of the principal questions concerning the gastric carcinogenesis. Are

Figure 5.
Early gastric adenocarcinoma
Considering these important questions, our chapter is divided into two sections: 1. the identification of the principal genetic characteristics of
4. Materials and methods
4.1. Determination of principal genotypes of H. Pylori in Brazilian patients with early gastric adenocarcinoma
4.1.1. Clinical samples
Clinical isolates of
4.1.2. Methods
Paraffin wax-embedded tissue DNA extraction was carried out with xylene and ethanol washes for paraffin removal; successive steps using proteinase K, phenol, chloroform, and isoamyl alcohol were carried out in order to isolate and purify the DNA [90]. Quantification of the obtained product and polymerase chain reaction (PCR) for human betaglobin gene [91] were carried out to guarantee the quality of all the results.
After DNA extraction, PCR for ureaseC [92], vacA (s and m) [93,94,95], cagA [96], cagT [97] and dupA (jhp0917 and jhp0918) [49] genes were performed. Primers pairs for all the genes as well as the length of the fragments are described in Table 1. PCR for ureaseC gene was carried out to confirm the positivity for
After amplification, each PCR product was analyzed by eletrophoresis on a 2% agarose gel stained with ethidium bromide with a 0.5 X tris-acetate-EDTA buffer. A 100-bp ladder was used as standard.
|
|
|
|
|
| betaglobin | + - |
ACAAACTGTGTTCACTAGC CAACTTCATCCACGTTTCACC |
110 |
| ureaseC | + - |
AAGCTTTAGGGGTGTTAGGGGTTT AAGCTTACTTTCTAACACTAACGC |
294 |
| vacA (s1/s2) | + - |
ATGGAAATACAACAAACACAC CTGCTTGAATGCGCCAAAC |
s1: 259 s2: 286 |
| vacA m1 | + - |
GGTCAAAATGCGGTCATGG CCATTGGTACCTGTAGAAAC |
290 |
| vacA m2 | + - |
ATGCTTTAATATCGTTGAGA GAACATGTTTTAGTGAAAGC |
198 |
| cagA | + - |
GATAACAGGCAAGCTTTTGAGG CTGCAAAAGATTGTTTGGCAGA |
349 |
| cagT | + - |
CCATGTTTATACGCCTGTGT CATCACCACACCCTTTTGAT |
301 |
| dupA (jhp0917) | + - |
TGGTTTCTACTGACAGAGCGC AACACGCTGACAGGACAATCTCCC |
307 |
| dupA (jhp0918) | + - |
CCTATATCGCTAACGCGCGCTC AAGCTGAAGCGTTTGTAACG |
276 |
Table 1.
Then, for each specific reaction, products obtained were classified in vacA s1m1, s2m1, s1m2 or s2m2; cagA positive or negative; cagT positive or negative; and dupA positive or negative. dupA gene was considered positive when its two regions (jhp0917 and jhp0918) were positive simultaneously.
After all amplifications, a table with absolute frequencies (n) and percentages (%) was made in order to determine genotypes combinations.
4.2. Analysis of the principal manuscript references concerning the study of eradication treatment of H. pylori in precancerous lesions and early gastric cancer
After determination of the principal genotype presented in Brazilian patients with early gastric cancer, a review concerning the importance of eradication of
5. Results
5.1. Determination of principal genotypes of H. Pylori in Brazilian patients with early gastric adenocarcinoma
PCR for ureaseC gene of
|
|
|
| UreaseC | 31 (100.0%) |
| vacA s1 vacA s2 |
22 (71.0%) 9 (29.0%) |
| vacA m1 vacA m2 |
31 (100.0%) 0 (0.0%) |
| vacA s1m1 vacA s2m1 |
22 (71.0%) 9 (29.0%) |
| cagA positive cagA negative |
19 (61.3%) 12 (38.7%) |
| cagT positive cagT negative |
17 (54.8%) 14 (45.2%) |
| dupA (jhp0917/jhp0918) positive dupA (jhp0917/jhp0918) negative |
11 (35.5%) 20 (64.5%) |
| Total | 31 (100.0%) |
Table 2.
Frequencies and percentages of the principal genes of
As regards to gene cagA, 61.3% (19 cases) were cagA positive and, for cagT gene, 54.8% (17 cases) were positive. For dupA (jhp0917/jhp0918) gene, there were 35.5% (11 cases) of positivity. All these results can be seen in Table 2.
Genotypes combinations where then analyzed and the most prevalent genotype for gastric samples obtained from Brazilian patients with early distal type intestinal gastric adenocarcinoma was vacA s1m1, cagA positive, cagT positive and dupA negative (Table 3).
|
|
|
| s1m1 neg neg neg | 4 (12.90) |
| s1m1 neg neg pos | 1 (3.23) |
| s2m1 neg neg neg | 1 (3.23) |
| s2m1 neg neg pos | 0 (0.00) |
| s1m1 neg pos neg | 2 (6.45) |
| s1m1 neg pos pos | 1 (3.23) |
| s2m1 neg pos neg | 2 (6.45) |
| s2m1 neg pos pos | 1 (3.23) |
| s1m1 pos neg neg | 3 (9.68) |
| s1m1 pos neg pos | 2 (6.45) |
| s2m1 pos neg neg | 2 (6.45) |
| s2m1 pos neg pos | 1 (3.23) |
| s1m1 pos pos neg | 5 (16.13) |
| s1m1 pos pos pos | 4 (12.90) |
| s2m1 pos pos neg | 2 (6.45) |
| s2m1 pos pos pos | 0 (0.00) |
|
|
|
Table 3.
Genotype combinations for early gastric adenocarcinoma samples
5.2. Analysis of the principal manuscript references concerning the study of eradication treatment of H. pylori in precancerous lesions and early gastric cancer
Epidemiological studies have established a strong causal relationship between
Considering these important issues, the present chapter book analized and discussed some studies that assessed the possible relationship between the eradication of
6. Discussion
Molecular techniques may be applied to the measurement of host or agent factors and of exposures. Molecular techniques help to stratify and to refine data by providing more sensitive and specific measurements, which facilitate epidemiologic activities, including disease surveillance, outbreak investigations, identifying transmission patterns and risk factors among apparently disparate cases, characterizing host-pathogen interactions, detecting uncultivatable organisms, providing clues for possible infectious causes of cancer and other chronic diseases, and providing better understanding of disease pathogenesis at the molecular level [98].
Our study determined the principal genotype of
Many factors, including a high-salt diet [99], genetic abnormality [100] and autoimmune gastritis [101], among others, have been reported concerning gastric carcinogenesis; however, it is clear that
Currently recommended anti-
Some studies focused on patients with gastric precancerous lesions such as gastric atrophy, intestinal metaplasia and dysplasia and evaluated the effect of eradicating
Conflicting results have been reported on whether or not these precancerous lesions were reversible following successful eradication of
The investigation of Uemura et al. (2001) [108] is considered the first study providing some evidence that
In a randomized placebo controlled study in China, gastritis (acute and chronic) decreased in both the antrum and the corpus at one year after
In Colombia, a randomized, controlled chemoprevention trial with patients with confirmed multifocal nonmetaplastic atrophy and/or intestinal metaplasia demonstrated that, after
Other follow-up studies also identified that
Concerning to patients with gastric atrophy, the most part of the studies have identified that this lesion presents a regression when
As well as other authors mentioned before, Ito (2009) [132] considered that theoretically
Wong et al. (2004) [134], with the aim to determine whether eradication of
As regards to animal models, they are useful because they represent tractable systems that permit insights into the effects of host, pathogen and environmental factors on gastric carcinogenesis [136]. Nevertheless, the use of animals does not completely reflect
A 5-year study in Japanese monkeys (
In the mouse model, both
Finally, for cancers detected early, endoscopic mucosal resection can conserve the noncancerous gastric mucosa, but it can not eliminate the recurrence of metachronous gastric cancer [145]. Fukase et al. (2008) [131], in a randomized control trial, studied a group of patients submitted to
Briefly, the most part of the studies suggests that
7. Conclusions
All the available evidence suggests that
More research is needed to elucidate mechanisms underlying the
Finally, it is important to gain more insight into the pathogenesis of H. pylori-induced gastric adenocarcinoma, not only to develop more effective treatments for this cancer, but also because it might serve as a paradigm for the role of chronic inflammation in the genesis of other malignancies.
References
- 1.
Kusters JG, van Vliet AHM, Kuipers EJ. Pathogenesis of Helicobacter pylori infection. Clinical Microbiology Reviews 2006; 19(3): 449-490. - 2.
Goodwin CS, Armstrong JA. Microbiological aspects of Helicobacter pylori (Campylobacter pylori ). European Journal of Clinical Microbiology 1990; 9(1): 1-13. - 3.
Bode G, Mauch F, Malfertheiner P. The coccoid forms of Helicobacter pylori. Criteria for their viability. Epidemiology and Infection 1993; 111(3): 483-490. - 4.
Blaser MJ. An endangered species in the stomach. Scientific American 2005; 292(2): 38-45. - 5.
Ahmed N. 23 years of the discovery of Helicobacter pylori: Is the debate over? Annals of Clinical Microbiology and Antimicrobials 2005; 4: 17-19. - 6.
Replogle ML, Glaser SL, Hiatt RA, Parsonnet J. Biologic sex as a risk factor for Helicobacter pylori infection in healthy young adults. American Journal of Epidemiology 1995; 142(8): 856-863. - 7.
Graham DY, Malaty HM, Evans DG, Evans DJ, Klein PD, Adam E. Epidemiology of Helicobacter pylori in an asymptomatic population in the United States. Gastroenterology 1991; 100(6): 1495-1501. - 8.
Urita Y, Watanabe T, Kawagoe N, Takemoto I, Tanaka H, Kijima S, Kido H, Maeda T, Sugasawa Y, Miyazaki T, Honda Y, Nakanishi K, Shimada N, Nakajima H, Sugimoto M, Urita C. Role of infected grandmothers in transmission of Helicobacter pylori to children in a Japanese rural town. Journal of Paediatrics and Child Health 2013; 49(5): 394-398. - 9.
Bastos J, Carreira H, La Vecchia C, Lunet N. Childcare attendance and Helicobacter pylori infection: systematic review and meta-analysis. European Journal of Cancer Prevention 2013; 22(4): 311-319. - 10.
Covacci A, Telford JL, Del Giudice G, Parsonnet J, Rapuolli R. Helicobacter pylori virulence and genetic geography. Science 1998; 284(5418): 1328-1333. - 11.
Dubois A, Fiala N, Heman-Ackah LM, Drazek ES, Tarnawski A, Fishbein WN, Perez-Perez GI, Blaser MJ. Natural gastric infection with Helicobacter pylori in monkeys: a model for spiral bacteria infection in humans. Gastroenterology 1994; 106(6): 1405-1417. - 12.
Fox JG, Batchelder M, Marini R, Yan L, Handt L, Li X, Shames B, Hayward A, Campbell J, Murphy JC. Helicobacter pylori -induced gastritis in the domestic cat. Infection and Immunity 1995; 63(7): 2674-2681. - 13.
Grubel P, Hoffman JS, Chong FK, Burstein NA, Mepani C, Cave DR. Vector potential of houseflies ( Musca domestica ) forHelicobacter pylori . Journal of Clinical Microbiology 1997; 35(6): 1300-1303. - 14.
Dunn BE, Cohen H, Blaser MJ. Helicobacter pylori . Clinical Microbiology Reviews 1997; 10(4): 720-741. - 15.
Lu Y, Redlinger TE, Avitia R, Galindo A, Goodman K. Isolation and genotyping of Helicobacter pylori from untreated municipal wastewater. Applied and Environmental Microbiology 2002; 68(3): 1436-1439. - 16.
Bahrami AR, Rahimi E, Ghasemian Safaei H. Detection of Helicobacter pylori in City Water, Dental Unit´s Water and Bottled Mineral Water in Isfahan, Iran. Scientific World Journal 2013. - 17.
Marshall BJ, Warren JR. Unidentified curved bacilli in the stomach of patients with gastritis and peptic ulceration. Lancet 1984; 1(8390): 1311-1315. - 18.
Ahmed N, Sechi LA. Helicobacter pylori and gastroduodenal pathology. New threats of the old friend. Annals of Clinical Microbiology and Antimicrobials 2005; 4:1-10. - 19.
International Agency for Research on Cancer. Schistosomes, liver flukes and Helicobacter pylori. IARC Working Group on the Evaluation of Carcinogenic Risks to Humans. IARC monographs on the evaluation of carcinogenic risks to humans. World Health Organization, International Agency for Research on Cancer 1994; 61: 1-241. - 20.
Capurso G, Lahner E, Marcheggiano A, Caruana P, Carnuccio A, Bordi C, Delle Fave G, Annibale B. Involvement of the corporal mucosa and related changes in gastric acid secretion characterize patients with iron deficiency anemy associated with Helicobacter pylori infection. Alimentary Pharmacology & Therapeutics 2001; 15(11): 1753-1761. - 21.
Pelicano R, Franceschi F, Saracco G, Fagoonee S, Roccarina D, Gasbarrini A. Helicobacters and extragastric diseases. Helicobacter 2009; 14(Suppl 1): 58-68. - 22.
Arnold DM, Bernotas A, Nazi I, Stasi R, Kuwana M, Liu Y, Kelton JG, Crowther MA. Platelet count response to H. pylori treatment in patients with immune thrombocytopenic purpura with and withoutH. pylori infection: a systematic review. Haematologica 2009; 94(6): 850-856. - 23.
Franceschi F, Navarese EP, Mollo R, Giupponi B, De Marco G, Merra G, Gasbarrini G, Silveri NG. Helicobacter pylori and atherosclerosis. A review of the literature. Recenti Progressi in Medicina 2009; 100(2): 91-96. - 24.
Rogha M, Nikvarz M, Poumoghaddas Z, Shirneshan K, Dadkhah D, Poumoghaddas M. Is Helicobacter pylori infection a risk factor for coronary heart disease? ARYA Atherosclerosis 2012; 8(1): 5-8. - 25.
Isaeva GSh, Abuzarova ER, Valeeva IuV, Pozdeev OK, Murav´eva EV. Helicobacter pylori in patients with disorders of hepatobiliary system. Zh Mikrobiol Epidemiol Immunobiol 2009; 2: 96-101. - 26.
Pirouz T, Zounubi L, Keivani H, Rakhshani N, Hormazdi M. Detection of Helicobacter pylori in paraffin-embedded specimens from patients with chronic liver diseases, using the amplification method. Digestive Diseases and Sciences 2009; 54(7): 1456-1459. - 27.
Zhou X, Zhang C, Wu J, Zhang G. Association between Helicobacter pylori infection and diabetes mellitus: a meta-analysis of observational studies. Diabetes Research and Clinical Practice 2013; 99(2): 200-208. - 28.
Blaser MJ, Berg DE. Helicobacter pylori genetic diversity and risk of human disease. The Journal of Clinical Investigation 2001; 107(7): 767-773. - 29.
Suerbaum S, Michetti P. Helicobacter pylori infection. New England Journal of Medicine 2002; 347(15): 1175-1186. - 30.
Megraud F, Neman-Simha, Brugmann D. Further evidence of the toxic effect of ammonia produced by Helicobacter pylori urease on human epithelial cells. Infection and Immunity 1992; 60(5): 1858-1863. - 31.
Suzuki M, Miura S, Suematsu M, Fukumura D, Kurose I, Suzuki H, Kai A, Kudoh Y, Ohashi M, Tsuchiya M Helicobacter pylori -associated ammonia production enhances neutrophil-dependent gastric mucosal cell injury. American Journal of Physiology 1992; 263 (5 Pt 1): G719-725. - 32.
Montecucco C, Rapuolli R. Living dangerously: how Helicobacter pylori survives in the human stomach. Nature Reviews. Molecular Cell Biology 2001; 2(6): 457-466. - 33.
Harris PR, Mobley HL, Perez-Perez GI, Blaser MJ, Smith PD. Helicobacter pylori urease is a potent stimulus of mononuclear phagocyte activation and inflammatory cytokine production. Gastroenterology 1996; 111(2): 419-425. - 34.
Leunk RD, Johnson PT, David BC, Kraft WG, Morgan DR. Cytotoxic activity in broth-culture filtrates of Campylobacter pylori . Journal of Medical Microbiology 1988; 26(2): 93-99. - 35.
Amieva MR, El-Omar EM. Host-bacterial interactions in Helicobacter pylori infection. Gastroenterology 2008; 134(1): 306-323. - 36.
Atherton JC, Cao P, Peek RMJr, Tummuru MK, Blaser MJ, Cover TL. Mosaicism in vacuolating cytotoxin alleles of Helicobacter pylori . Association of specific vacA types with cytotoxin production and peptic ulceration.Journal of Biological Chemistry 1995; 270(30): 17771-17777. - 37.
Covacci A, Rappuoli R. Tyrosine-phosphorylated bacterial proteins: Trojan horses for the host cell. Journal of Experimental Medicine 2000; 191(4): 587-592. - 38.
Backert S, Selbach M. Role of type IV secretion in Helicobacter pylori pathogenesis. Cellular Microbiology 2008; 10(8): 1573-1581. - 39.
Hatakeyama M. Oncogenic mechanisms of the Helicobacter pylori CagA protein. Nature Reviews. Cancer 2004; 4(9): 688-694. - 40.
Higashi H, Tsutsumi R, Muto S, Sugiyama T, Azuma T, Asaka M, Hatakeyama M. SHP-2 tyrosine phosphatase as an intrancellular target of Helicobacter pylori CagA protein. Science 2002; 295(5555): 683-686. - 41.
Murata-Kamiya N, Kurashima Y, Teishikata Y, Yamahashi Y, Saito Y, Higashi H, Aburatani H, Akiyama T, Peek RMJr, Azuma T, Hatakeyama M. Helicobacter pylori CagA interacts with E-cadherin and deregulates the β-catenin signal that promotes intestinal transdifferentiation in gastric epithelial cells. Oncogene 2007; 26(32): 4671-4626. - 42.
Amieva MR, Vogelmann R, Covacci A, Tompkins LS, Nelson WJ, Falkow S. Disruption of the epithelial apical-junctional complex by Helicobacter pylori CagA. Science 2003; 300(5624): 1430-1434. - 43.
Suzuki M, Mimuro H, Suzuki T, Park M, Yamamoto T, Sasakawa C. Interaction of CagA with Crk plays an important role in Helicobacter pylori -induced loss of gastric epithelial cell adhesion. Journal of Experimental Medicine 2005; 202(9): 1235-1247. - 44.
Brandt S, Kwok T, Hartig R, Konig W, Backert S. NF-kappaB activation and potentiation of proinflammatory responses by the Helicobacter pylori CagA protein. Proceedings of the National Academy of Sciences of the United States of America 2005; 102(26): 9300-9305. - 45.
Blaser MJ, Perez-Perez GI, Kleanthous H, Cover TL, Peek RM, Chyou PH, Stemmermann GN, Nomura A. Infection with Helicobacter pylori strains possessing cagA is associated with an increased risk of developing adenocarcinoma of the stomach. Cancer Research 1995; 55(10): 2111-2115. - 46.
Parsonnet J, Friedman GD, Orentreich N, Vogelman H. Risk for gastric cancer in people with CagA positive or CagA negative Helicobacter pylori infection. Gut 1997; 40(3): 297-301. - 47.
Figueiredo C, van Doorn LJ, Nogueira C, Soares JM, Pinho C, Figueira P, Quint WG, Carneiro F. Helicobacter pylori genotypes are associated with clinical outcome in Portuguese patients and show a high prevalence of infections with multiple strains. Scandinavian Journal of Gastroenterology2001; 36(2): 128-135. - 48.
Roesler BM, Costa SCB, Zeitune JMR. Virulence factors of Helicobacter pylori and their relationship with the development of early and advanced distal intestinal type gastric adennocarcinoma. In: Paola Tonino (ed.). Gastritis and gastric cancer. New insights in gastroprotection, diagnosis and treatments. Rijeka: InTech; 2011. - 49.
Lu H, Hsu P, Graham DY, Yamaoka Y. Duodenal ulcer promoting gene of Helicobacter pylori. Gastroenterology 2005; 128(4): 833-848. - 50.
Zhang Z, Zheng Q, Chen X, Xiao S, Liu W, Lu H. The Helicobacter pylori duodenal ulcer promoting gene, dupA in China. BMC Gastroenterology 2008; 8: 49-54. - 51.
Yamaoka Y. Roles of the plasticity regions of Helicobacter pylori in gastroduodenal pathogenesis. Journal of Medical Microbiology 2008; 57(5): 545-553. - 52.
Douraghi M, Mohammadi M, Oghalaie A, Abdirad A, Mohagheghi MA, Hosseini ME, Zeraati H, Ghasemi A, Esmaieli M, Mohajerani N. dupA as a risk determinant in Helicobacter pylori infection. Journal of Medical Microbiology 2008; 57 (Pt.5): 554-562. - 53.
Argent RH, Burette A, Miendje Deyi VY, Atherton JC. The presence of dupA in Helicobacter pylori is not significantly associated with duodenal ulceration in Belgium, South Africa, China or North America. Clinical Infectious Diseases 2007; 45(9): 1204-1206. - 54.
Schimidt HMA, Andres S, Kaakoush NO, Engstrand L, Eriksson L, Goh KL, Fock KM, Hilmi I, Dhamodaran S, Forman D, Mitchell H. The prevalence of the duodenal ulcer promoting gene (dupA) in Helicobacter pylori isolates varies by ethnic group and is not universally associated with disease development: a case-control study. Gut Pathogens 2009; 1(1): 5-13. - 55.
Roesler BM, Oliveira TB, Costa SCB, Zeitune JMR. Is there any relationship between Helicobacter pylori dupA gene and the development of early and advanced gastric cancer in Brazilian patients? Journal of Medical Research and Science 2011; 2(1): 15-24. - 56.
Arachchi HSJ, Kalra V, Lal B, Bhatia V, Baba CS, Chakravarthy S, Rohatgi S, Sarma PM, Mishra V, Das B, Ahuja V. Prevalence of duodenal ulcer promoting gene (dupA) of Helicobacter pylori in patients with duodenal ulcer in North Indian population. Helicobacter. 2007; 12(6): 591-597 - 57.
Gressmann H, Linz B, Ghai R, Pleissner KP, Schlapbach R, Yamaoka Y, Kraft C, Suerbaum S, Meyer TF, Achtman M. Gain and loss of multiple genes during the evolution of Helicobacter pylori. PLoS Genetics2005; 1(4): e43. - 58.
Siegel R, Ward E, Brawley O, Jemal A. Cancer statistics, 2011. The impact of eliminating socioeconomic and racial disparities on premature cancer deaths. CA. a cancer journal for clinicians 2011; 61(4): 212-236. - 59.
Bray F, Jemal A, Grey N, Ferlay J, Forman D. Global cancer transition according to the Human Development Index (2008-2030): a population-based study. Lancet Oncology 2012, 13(8): 790-801. - 60.
World Health Organization. Global action against cancer. Global cancer control. WHO Library Cataloguing-in-Publication Data. Switzerland 2005. http://www.who.int/cancer/media/en/GlobalActionCancerEnglfull.pdf (accessed 01 december 2013). - 61.
Malfertheiner P, Bornschein J, Selgrad M. Role of Helicobacter pylori infection in gastric cancer pathogenesis: a chance for prevention. Journal of Digestive Diseases 2010; 11(1): 2-11. - 62.
Nardone G, Rocco A, Malfertheiner P. Review article: Helicobacter pylori and molecular events in precancerous gastric lesions. Alimentary pharmacology & therapeutics 2004; 20(3): 261-270. - 63.
Hoehnberger P, Gretschel S. Gastric cancer. Lancet 2003; 362(9380): 305-315. - 64.
Bowles MJ, Benjamin IC. ABC of the upper gastrointestinal tract. Cancer of the stomach and pancreas. BMJ 2001; 323(7326): 1413-1416. - 65.
Verdecchia A, Mariotto A, Gatta G, Bustamante-Teixeira MT, Ajiki W. Comparison of stomach cancer incidence and survival in four continents. European Journal of Cancer 2003; 39(11): 1603-1609. - 66.
Guerra MR, Gallo CVM, Mendonça GAS. The risk of cancer in Brazil: tendencies and recent epidemiologic studies. Revista Brasileira de Cancerologia 2005; 51(3): 227-234. - 67.
Ministério da Saúde. Instituto Nacional do Câncer José Alencar Gomes da Silva. Estimativa 2014 – Incidência de Câncer no Brasil. MS: http://www2.inca.gov.br (accessed 29 November 2013). - 68.
Lauren P. The two histological main types of gastric carcinoma: Diffuse and so-called intestinal type carcinoma. Acta Pathologica et Microbiologica Scandinavica 1975; 64: 31-49. - 69.
Sugiyama T, Asaka M. Helicobacter pylori infection and gastric cancer. Medical Electron Microscopy 2004; 37(3): 149-157. - 70.
Yoshimura T, Shimoyama T, Fukuda S, Tanaka M, Axon AT, Munakata A. Most gastric cancer occurs on the distal side of the endoscopic atrophic border. Scandinavian Journal of Gastroenterology 1999; 34(11): 1077-1081. - 71.
Polk DB; Peek Jr RM. Helicobacter pylori : gastric cancer and beyond. Nature Reviews. Cancer 2010; 10(6): 403-414. - 72.
Correa P, Haenszel W, Cuello C, Tannenbaum S, Archer M. A model for gastric cancer epidemiology. Lancet 1975; 2(7924): 58-60. - 73.
Correa P. A human model of gastric carcinogenesis. Cancer Research 1988; 48(13): 3554-3560. - 74.
Correa P. Human gastric carcinogenesis: a multistep and multifactorial process – First American Cancer Society Award lecture on cancer epidemiology and prevention. Cancer Research 1992; 52(24): 6735-6740. - 75.
Correa P, Piazuelo MB. The gastric precancerous cascade. Journal of Digestive Diseases 2012; 13(1): 2-9. - 76.
Mera R, Fontham ET, Bravo LE, Bravo JC, Piazuelo MB, Camargo MC, Correa P. Long term follow up of patients treated for Helicobacter pylori infection. Gut 2005; 54(11): 1536-1540. - 77.
Cheung TK, Xia HH, Wong BCY. Helicobacter pylori eradication for gastric cancer prevention. Journal of Gastroenterology 2007; 42(Suppl. 17): 10-15. - 78.
Yang Y, Deng CS, Peng JZ, Wong BC, Lam SK, Xia HH. Effect of Helicobacter pylori on apoptosis and apoptosis related genes in gastric cancer cells. Molecular Pathology 2003; 56(1): 19-24. - 79.
Kuipers EJ. Review article: relationship between Helicobacter pylori , atrophic gastritis and gastric cancer. Alimentary pharmacology & therapeutics 1998; 12(Suppl 1): 25-36. - 80.
Forman D, Newell DG, Fullerton F, Yarnell JW, Stacey AR, Wald N, Sitas F. Association between infection with Helicobacter pylori and risk of gastric cancer: evidence from a prospective investigation. BMJ 1991; 302(6788): 1302-1305. - 81.
Danesh J. Helicobacter pylori infection and gastric cancer: systemic review of the epidemiological studies. Alimentary pharmacology & therapeutics 1999; 13(7): 851-856. - 82.
Herrera V, Parsonnet J. Helicobacter pylori and gastric adenocarcinoma. Clinical Microbiology and Infection 2009; 15(11): 971-976. - 83.
de Vries AC, Haringsma J, Kuipers EJ. The detection, surveillance and treatment of premalignant gastric lesions related to Helicobacter pylori infection. Helicobacter 2007; 12(1): 1-15. - 84.
Correa P, Houghton J. Carcinogenesis of Helicobacter pylori . Gastroenterology 2007; 133(2): 659-672. - 85.
Filipe MI, Potet F, Bogomoletz WV, Dawson PA, Fabiani B, Chauveinc P, Fenzy A, Gazzard B, Goldfain D, Zeegen R. Incomplete sulphomucin-secreting intestinal metaplasia for gastric cancer. Preliminary data from a prospective study from three centres. Gut 1985; 26(12): 1319-1326. - 86.
Rugge M, Correa P, Dixon MF, Haltori T, Leandro G, Lewin K, Riddeli RH, Sipponen P, Watanabe H. Gastric dysplasia: the Padova international classification. The American journal of surgical pathology 2000; 24(2): 167-176. - 87.
Lauwers GY, Srivastava A. Gastric preneoplastic lesions and epithelial dysplasia. Gastroenterology clinics of North America 2007; 36(4): 813-829. - 88.
Hirota WK, Zuckerman MJ, Adler DG, Davila RE, Egan J, Leighton JA, Qureshi WA, Rajan E, Fanelli R, Wheeler-Harbaugh J, Baron TH, Faigel DO. ASGE guideline: the role of endoscopy in the surveillance of premalignant conditions of the upper GI tract. Gastrointestinal Endoscopy 2006; 63(4): 570-580. - 89.
Everett SM, Axon ATR. Early gastric cancer: disease or pseudo-disease? Lancet 1998; 351(9112): 1350-1352. - 90.
Goelz SE, Hamilton SR, Vogelstein B. Purification of DNA from formaldehyde fixed and paraffin embedded human tissue. Biochemical and Biophysical Research Communications 1985; 130(1): 118-126. - 91.
Saiki RK, Gelfand DH, Stoffel S, Scharf SJ, Higuchi R, Horn GT, Mullis KB, Erlich HA. Primer-directed enzymatic amplification of DNA with a termostable DNA polymerase. Science 1988; 239(4839): 487-491. - 92.
Lage AP, Godfroid P, Fauconnier A, Burette A, Butzler JP, Bollen A, Glupczynski Y. Diagnosis of Helicobacter pylori infection by PCR: comparison with other invasive techniques and detection of cagA gene in gastric biopsy specimens. Journal of Clinical Microbiology 1995; 33(10): 2752-2756. - 93.
Atherton JC, Peek RM, Tham KT, Cover TL, Blaser MJ. Clinical and pathological importance of heterogenicity in vacA, the vacuolating cytotoxin gene of Helicobacter pylori . Gastroenterology 1997; 112(1): 92-97. - 94.
Atherton JC, Cover TL, Twells RJ, Morales MR, Hawkey CJ, Blaser MJ. Simple and accurate PCR-based system for typing vacuolating cytotoxin alleles of Helicobacter pylori . Journal of Clinical Microbiology 1999; 37(9): 2979-2982. - 95.
Thomazini CM, Pinheiro NA, Pardini MI, Naresse LE, Rodrigues MAM. Infecção por Helicobacter pylori e câncer gástrico: freqüência de cepas patogênicas cagA e vacA em pacientes com câncer gástrico. Jornal Brasileiro de Patologia e Medicina Laboratorial 2006; 42(1): 25-30. - 96.
Faundez G, Troncoso M, Figueroa G. cagA and vacA in strains of Helicobacter pylori from ulcer and non-ulcerative dyspepsia patients. BMC Gastroenterology 2002; 2:20-24. - 97.
Mattar R, Marques SB, Monteiro MS, Santos AF, Iriya K, Carrilho FJ. Helicobacter pylori cag pathogenicity island genes: clinical relevance for peptic ulcer disease development in Brazil. Journal of Medical Microbiology 2007; 56(1): 9-14. - 98.
Foxman B, Riley L. Molecular Epidemiology: Focus on Infection. American Journal of Epidemiology 2001; 153(12): 1135-1141. - 99.
Nozaki K, Shimizu N, Inada K, Tsukamoto T, Inoue M, Kumagai T, Sugiyama A, Mizoshita T, Kaminishi M, Tatematsu M. Synergistic promoting effects of Helicobacter pylori infection and high-salt diet on gastric carcinogenesis in Mongolian gerbils. Japanese Journal of Cancer Research 2002; 93(10): 1083-1089. - 100.
Humar B, Blair V, Charlton A, More H, Martin I, Guilford P, E-cadherin deficiency initiates gastric signet-ring cell carcinoma in mice and man. Cancer Research 2009; 69(5): 2050-2056. - 101.
Fukayama M, Hino R, Uozaki H. Epstein-Barr vírus and gastric carcinoma: vírus-host interactions leading to carcinoma. Cancer Science 2008; 99(9): 1726-1733. - 102.
Suzuki H, Hibi T, Marshall BJ. Helicobacter pylori: present status and future prospects in Japan. Journal of Gastroenterology 2007; 42(1): 1-15. - 103.
Xia HH, Yu Wong BC, Talley NJ, Lam SK. Alternative and rescue treatment regimens for Helicobacter pylori eradication. Expert Opinion of Pharmacotherapy 2002; 3(9): 1301-1311. - 104.
Parsonnet J, Harris RA, Hack HM, Owens DK. Modelling cost-effectiveness of Helicobacter pylori screening to prevent gastric cancer: a mandate for clinical trials. Lancet 1996; 348(9021): 150-154. - 105.
Fendrick AM, Chernew ME, Hirth RA, Bloom BS, Bandekar RR, Scheiman JM. Clinical and economic effects of population-based Helicobacter pylori screening to prevent gastric cancer. Archives of Internal Medicine 1999; 159(2): 142-148. - 106.
Roderick P, Davies R, Raftery J, Crabbe D, Pearce R, Patel P et al. Cost-effectiveness of population screening for Helicobacter pylori in preventing gastric cancer and peptic ulcer disease, using simulation. Journal of Medical Screening 2003; 10(3): 148-156. - 107.
Fuccio L, Zagari RM, Minardi ME, Bazzoli F. Systematic review. Helicobacter pylori eradication for the prevention of gastric cancer. Alimentary Pharmacology & Therapeutics 2007; 25(2): 133-141. - 108.
Uemura N, Okamoto S, Yamamoto S, Matsumura M, Yamaguchi S, Yamakido M, Taniyama K, Sasaki N, Schlemper RJ. Helicobacter pylori infection and the development of gastric cancer. New England Journal of Medicine 2001; 345(11): 784-789. - 109.
Leung WK, Lin SR, Ching JY, To KF, Ng EK, Chan FK, Lau JY, Sung JJ. Factors predicting progression of gastric intestinal metaplasia. Results of a randomized trial on Helicobacter pylori eradication. Gut 2004; 53(9): 1244-1249. - 110.
Zhou L, Sung JJ, Lin S, Jin Z, Ding S, Huang X, Xia Z, Guo H, Liu J, Chao W. A five-year follow-up study on the pathological changes of gastric mucosa after H. pylori eradication. Chinese Medical Journal 2003; 116(1): 11-14. - 111.
Correa P, Fontham ET, Bravo JC, Bravo LE, Ruiz B, Zarama G, Realpe JL, Malcom GT, Li D, Johnson WD, Mera R. Chemoprevention of gastric dysplasia: randomized trial of antioxidant supplements and anti- Helicobacter pylori therapy. Journal of the National Cancer Institute 2000; 92(23): 1881-1888. - 112.
Genta RM, Lew GM, Graham DY. Changes in the gastric mucosa following eradication of Helicobacter pylori . Modern Pathology 1993; 6(3): 281-289. - 113.
Ciok J, Dzieniszewski J, Lucer C. Helicobacter pylori eradication and antral intestinal metaplasia – two years follow-up study. Journal of Physiology and Pharmacology 1997; 48(Suppl. 4): 115-122. - 114.
Uemura N, Mukai T, Okamoto S, Yamaguchi S, Mashiba H, Taniyama K, Sasaki N, Haruma K, Sumii K, Kajiyama G. Effect of Helicobacter pylori eradication on subsequent development of cancer after endoscopic resection of early gastric cancer. Cancer Epidemiology, Biomarkers & Prevention 1997; 6(8): 639-642. - 115.
Kim N, Lim SH, Lee KH, Choi SE, Jung HC, Song IS, Kim CY. Long-term effects of Helicobacter pylori eradication on intestinal metaplasia in patients with duodenal and benign gastric ulcers. Digestive Diseases and Sciences 2000; 45(9): 1754-1762. - 116.
Ohkusa T, Fujiki K, Takashimizu I, Kumagai J, Tanizawa T, Eishi Y, Yokoyama T, Watanabe M. Improvement in atrophic gastritis and intestinal metaplasia in patients in whom Helicobacter pylori was eradicated. Annals of Internal Medicine 2001; 134(5): 380-386. - 117.
Kokkola A, Sipponen P, Rautelin H, Härkönen M, Kosunen TU, Haaapiainen R, Puolakkainen P. The effect of Helicobacter pylori eradication on the natural course of atrophic gastritis with dysplasia. Alimentary Pharmacology & Therapeutics 2002; 16(3): 515-520. - 118.
Ito M, Haruma K, Kamada T, Mihara M, Kim S, Kitadai Y, Sumii M, Tanaka S, Yoshihara M, Chayama K. Helicobacter pylori eradication therapy improves atrophic gastritis and intestinal metaplasia: a 5-year prospective study of patients with atrophic gastritis. Alimentary Pharmacology & Therapeutics 2002; 16(8): 1449-1456. - 119.
You WC, Brown LM, Zhang L, Li JY, Jin ML, Chang YS, Ma JL, Pan KF, Liu WD, Hu Y, Crystal-Mansour S, Pee D, Blot WJ, Fraumeni JF Jr, Xu GW, Gail MH. Randomized double-blind factorial trial of three treatments to reduce the prevalence of precancerous gastric lesions. Journal of the National Cancer Institute 2006; 98(14): 974-983. - 120.
Ley C, Mohar A, Guarner J, Herrera-Goepfert R, Figueroa LS, Halperin D, Johnstone I, Parsonnet J. Helicobacter pylori eradication and gastric preneoplastic conditions: a randomized, double-blind, placebo-controlled trial. Cancer Epidemiology, Biomarkers & Prevention 2004; 13(1): 4-10. - 121.
Witteman EM, Mravunac M, Becx MJ, Hopman WP, Verschoor JS, Tytgat GN, de Koning RW. Improvement of gastric inflammation and resolution of epithelial damage one year after eradication of Helicobacter pylori . Journal of Clinical Pathology 1995; 48(3): 250-256. - 122.
Forbes GM, Warren JR, Glaser ME, Cullen DJ, Marshall BJ, Collins BJ. Long-term follow-up of gastric histology after Helicobacter pylori eradication. Journal of Gastroenterology and Hepatology 1996; 11(7): 670-673. - 123.
van der Hulst RW, van der Ende A, Dekker FW, Ten Kate FJ, Weel JF, Keller JJ, Kruizinga SP, Dankert J, Tytgat JN. Effect of Helicobacter pylori eradication on gastritis in relation to cagA: a prospective 1-year follow-up study. Gastroenterology 1997; 113(1): 25-30. - 124.
Satoh K, Kimura K, Takimoto T, Kihira K. A follow-up study of atrophic gastritis and intestinal metaplasia after eradication of Helicobacter pylori. Helicobacter 1998; 3(4): 236-240. - 125.
Kyzekova J, Mour J. The effect of eradication therapy on histological changes in the gastric mucosa in patients with non-ulcer dyspepsia and Helicobacter pylori infection. Prospective randomized intervention study. Hepatogastroenterology 1999; 46(27): 2048-2056. - 126.
Annibale B, Aprile MR, D´Ambra G, Caruana P, Bordi C, Delle Fave G. Cure of Helicobacter pylori infection in atrophic body gastritis patients does not improve mucosal atrophy but reduces hypergastrinemia and its related effects on body ECL-cell hyperplasia. Alimentary Pharmacology & Therapeutics 2000; 14(5): 625-634. - 127.
Sung JJ, Lin SR, Ching IY, Zhou LY, To KF, Wang RT, Leung WK, Ng EK, Lau JY, Lee YT, Yeung CK, Chao W, Chung SC. Atrophy and intestinal metaplasia one year after cure of H. pylori infection: a prospective, randomized study. Gastroenterology 2000; 119(1): 7-14. - 128.
Kamada T, Haruma K, Hata J, Kusunoki H, Sasaki A, Ito M, Tanaka S, Yoshihara M. The long-term effect of Helicobacter pylori eradication therapy on symptoms in dyspeptic patients with fundic atrophic gastritis. Alimentary Pharmacology & Therapeutics 2003; 18(2): 245-252. - 129.
Kuipers EJ, Nelis GF, Klinkenberg-Knol EC, Snel P, Goldfain D, Kolkman JJ, Festen HP, Dent J, Zeitoun P, Havu N, Lamm M, Walan A. Cure of Helicobacter pylori infection in patients with reflux oesophagitis treated with long term omeprazole reverses gastritis without exacerbation of reflux disease: results of a randomised controlled trial. Gut 2004; 53(1): 12-20. - 130.
Ruiz B, Garay J, Correa P, Fontham ET, Bravo JC, Bravo LE, Realpe JL, Mera R. Morphometric evaluation of gastric antral atrophy: improvement after cure of Helicobacter pylori infection. American Journal of Gastroenterology 2001; 96(12): 3281-3287. - 131.
Fukase K, Kato M, Kikuchi S, Inoue K, Uemura N, Okamoto S, Terao S, Amagai K, Hayashi S, Asaka M, Japan Gast Study Group. Effect of eradication of Helicobacter pylori on incidence of metachronous gastric carcinoma after endoscopic resection of early gastric cancer: an open-label, randomized controlled trial. Lancet 2008; 372(9636): 350-352. - 132.
Ito M, Takata S, Tatsugami M, Wada Y, Imagawa S, Matsumoto Y, Takamura A, Kitamura S, Matsuo T, Tanaka S, Haruma K, Chayama K. Clinical prevention of gastric cancer by Helicobacter pylori eradication therapy: a systematic review. Journal of Gastroenterology 2009; 44(5): 365-371. - 133.
Takata S, Ito M, Yoshihara M, Tanaka S, Imagawa S, Haruma K, Chayama K. Host factors contributing to the discovery of gastric cancer after successful eradication therapy of Helicobacter pylori: preliminary report. Journal of Gastroenterology and Hepatology 2007; 22(4): 571-576. - 134.
Wong BC, Lam SK, Wong WM, Chen JS, Zheng TT, Feng RE, Lai KC, Hu WH, Yuen ST, Leung SY, Fong DY, Ho J, Ching CK, Chen JS, China Gastric Cancer Study Group. Helicobacter pylori eradication to prevent gastric cancer in a high-risk region of China: a randomized controlled trial. JAMA 2004; 291(2): 187-194. - 135.
Kabir S. Effect of Helicobacter pylori eradication on incidence of gastric cancer in human and animal models: underlying biochemical and molecular events. Helicobacter 2004; 14(3): 159-171. - 136.
Rogers AB, Fox JG. Inflammation and Cancer. Rodent models of infectious gastrointestinal and liver cancer. American Journal of Physiology. Gastrointestinal and Liver Physiology 2004; 286(3): G361-G366. - 137.
Romero-Gallo J, Harris EJ, Krishna U, Washington MK, Perez-Perez GI, Peek Jr RM. Effect of Helicobacter pylori eradication on gastric carcinogenesis. Laboratory Investigation 2008; 88(3): 328-336. - 138.
Oda T, Murakami K, Nishizono A, Kodama M, Nasu M, Fujioka T. Long-term Helicobacter pylori infection in Japanese monkeys induces atrophic gastritis and accumulation of mutations in thep53 tumor suppressor gene. Helicobacter 2002; 7(3): 143-151. - 139.
Hirayama F, Takagi S, Kusuhara H, Iwao E, Yokoyama Y, Ykeda Y. Induction of gastric ulcer and intestinal metaplasia in mongolian gerbils infected with Helicobacter pylori . Journal of Gastroenterology 1996; 31(5): 755-757. - 140.
Shimizu N, Inada K, Nakanishi H, Tsukamoto T, Ikehara Y, Kaminishi M, Kuramoto S, Sugiyama A, Katsuyama T, Tatematsu M. Helicobacter pylori infection enhances glandular stomach carcinogenesis in Mongolian gerbils treated with chemical carcinogens. Carcinogenesis 1999; 20(4): 669-676. - 141.
Sugiyama A, Maruta F, Ikeno T, Ishida K, Kawasaki S, Katsuyama T, Shimizu N, Tatematsu M. Helicobacter pylori infection enhances N-methyl-N-nitrosourea-induced stomach carcinogenesis in the Mongolian gerbil. Cancer Research 1998; 58(10): 2067-2069. - 142.
Tokieda M, Honda S, Fujioka T, Nasu M. Effect of Helicobacter pylori infection on the N-methyl-N-nitro-N-nitrosoguanidine-induced gastric carcinogenesis in Mongolian gerbils. Carcinogenesis 1999; 20(7): 1261-1266. - 143.
Franco AT, Israel DA, Washington MK, Krishna U, Fox JG, Rogers AB, Neish AS, Collier-Hyams L, Perez-Perez GI, Hatakeyama M, Whitehead R, Gaus K, O´Brien DP, Romero-Gallo J, Peek RM Jr. Activation of beta-cateninby carcinogenic Helicobacter pylori . Proceedings of the National Academy of Sciences of the United States of America 2005; 102(30): 10646-10651. - 144.
Cai X, Carlson J, Stoicov C, Li H, Wang TC, Houghton J. Helicobacter felis eradication restores normal architecture and inhibits gastric cancer progression in C57BL/6 mice. Gastroenterology 2005; 128(7): 1937-1952. - 145.
Ono H, Kondo H, Gotoda T, Shirao K, Yamaguchi H, Saito D, Hosokawa K, Shimoda T, Yoshida S. Endoscopic mucosal resection for treatment of early gastric cancer. Gut 2001; 48(2): 225-229.