Journal of Pharmacy and Pharmacology 2 (2014) 104-113
D DAVID PUBLISHING
miRNA-146a and miRNA-200b Antagomirs Accelerate
Wound Healing through the Regulation of VEGF and
Fibronectin
Biao Feng1, Shali Chen1, Linbo Zhang1, 2, Yanan Cao1, 3 and Subrata Chakrabarti1
1. Department of Pathology, Western University, London N6A 5C1, Ontario, Canada
2. The School of Life Sciences, Jilin Agricultural University, Changchun 130118, Jilin, P.R. China
3. Heilongjiang Key Laboratory of Anti-fibrosis Biotherapy, Mudanjiang Medical University, Mudanjiang15700, Heilongjiang, P.R.
China
Received: December 04, 2013 / Accepted: February 07, 2014 / Published: February 28, 2014.
Abstract: miRNAs play important roles in the post-transcriptional regulation of most transcripts and control several biological
processes. We have shown that miR-200b regulates VEGF and miR-146a regulates ECM (extracellular matrix) protein, FN
(fibronectin) production. We examined the effects of these two miRNAs in wound healing in vitro and in animals with or without
diabetes. Microvascular ECs (endothelial cells) with or without miR inhibitor (antagomir) transfection were tested for VEGF and FN
production. Scratch assays and angiogenesis assays were performed. Wounds in the back of mice with or without
streptozotocin-induced diabetes were treated with antagomirs alone or in combinations. The wounds were measured and tissues were
examined for mRNAs, proteins and miRNAs and examined histologically. In the ECs, miR-200b or miR-146a inhibitors increased
VEGF and FN production, cell migration and tube formation. Wound healing in the animals, along with increased production of
specific proteins were accelerated by miR-200b or miR-146a inhibitor treatment and was pronounced when these two were combined.
In diabetes, although delayed, similar patterns were seen. These results indicated that combination of miR-146a and miR-200b
inhibitor treatment is useful in wound healing both in normal and in diabetic conditions. miRNA mediated wound healing may
potentially constitute a novel therapeutic approach.
Key words: miR-200b, miR-146a, wound healing, vascular endothelial growth factor, fibronectin.
1. Introduction factors for successful wound healing [3]. It has been
shown that such process can be stimulated by external
Wound healing remains a significant clinical
delivery of growth factors [3].
problem. In particular, non-healing chronic skin
MicroRNAs (miRNAs) are gaining attentions in
wounds are a common and severe complication of
several biologic processes as they play major roles in
diabetes and are associated with significant
gene regulation. These conserved ~20-25 nucleotide
morbidity [1]. Wound healing is impaired in the
long RNA molecules are produced from specific
diabetic population due to impaired circulation and
genes. They are controlled by tissue specific
increased susceptibility to infections [2]. From the
regulation and negatively regulate gene expression at
mechanistic standpoint, angiogenesis and increased
the post-transcriptional level by binding to the 3’ UTR
ECM (extracellular matrix) protein production are key
(untranslated region) of specific mRNAs [4]. Several
miRNAs have been found in the skin and are thought
Corresponding author: Subrata Chakrabarti, Ph.D.,
professor, research field: diabetic complications. E-mail:
to play a crucial role in a wide range of biologic
[email protected].
miRNA-146a and miRNA-200b Antagomirs Accelerate Wound Healing through the Regulation of VEGF 105
and Fibronectin
processes [5, 6]. angiogenesis and increased ECM protein production
Majority of primary miRNAs are produced by RNA and subsequently augmented wound healing. We also
polymerase II. They are then processed by RNase III hypothesized that a combination of these may have
enzyme Drosha to ~70 nucleotides long pre miRNA additive effects in both normal and diabetic
(precursor miRNAs). Pre-miRNAs are exported to the conditions.
cytoplasm and processed by RNase III enzyme dicer
2. Materials and Methods
to produce mature miRNA with one guide strand and
one passenger strand [7]. The former, through the 2.1 Animals
action of endonuclease argonaute, is integrated into
All animals were cared for according to the Guiding
functional RISC (RNA-induced silencing complex),
Principle in the Care and Use of Animals. All
whereas the later degraded [8]. miRNAs regulate gene
experiments were approved by the University of
expression by binding to the 3’-UTR of target mRNA.
Western Ontario Council on Animal Care Committee.
A perfect binding leads to mRNA degradation,
Male FVB mice (25-28g) were obtained from Charles
whereas imperfetct binding leads to translational
River Laboratories International, Inc. (MA, USA).
repression [9, 10]. Most miRNAs are negative
Diabetes was induced in randomly selected animals
regulators of gene expression. In some areas, however
using streptozocin. Methods of diabetes induction and
they have been found to cause gene activation [11, 12].
monitoring have been previously described in Ref. [16].
They have been implicated in a large number of
After 8 weeks, poorly controlled diabetes the animals
physiologic and pathologic processes [11].
were anesthetized by intraperitoneal injection of 100
Would healing require both angiogenesis and
mg/kg ketamine with 10 mg/kg xylazine. The back
production of extracellular matrix proteins. VEGF is
skin hair of mice was shaved, depilated with hair and
a known angiogenic factor and has been identified as
cleaned with alcohol. Using a sterile 4-mm biopsy
a key angiogenic factor in wound healing. VEGF
punch, four full thickness skin wounds were created
causes endothelial proliferation, keratinocyte
on the dorso-rostral back skin without injuring the
migration and collagen production [13]. In addition,
underlying muscle. Wounds were separated by a
a dynamic interaction among growth factors and
minimum of 5 mm of uninjured skin. The wounds
ECM protein such as collagen and FN (fibronectin)
were treated with specific miRNA antagomiRs or
are key parts of wound healing [14]. ECM proteins transfection reagent (see below). Wounds were
direct repair process by regulating behaviour of photographed at 0, 1, 3, 5 and 7 days after wounding
multiple cell types and modulating cell and matrix using a Canon digital camera. The wound area was
induction [15]. Hence, such processes may also be measured using PixeLINK software (Ottawa, Ontario,
exploited for therapy. Canada) and wound closure was expressed as
We have previously demonstrated that percentage of initial wound size. Mice were sacrificed
miRNA-200b is a regulator of VEGF. Reduced by CO2 euthanasia after 1, 3, and 7 days. A portion of
miR-200b production in diabetes leads to an increase the wound tissue was fixed in 10% neutral-buffered
in VEGF mRNA and protein production and formalin for histology and the remaining were kept
angiogenesis [10]. Similarly, we have shown that frozen for the gene expression.
reduced miRNA-146a leads to increased ECM protein
2.2 Antagomir Treatment
fibronectin production [16]. Hence, we explored
whether antagonism of these miRNAs will lead to The antagomirs were synthesized by Dharmacon
increased VEGF and FN production causing (Lafayette, CO, USA) based on mature microRNA
106 miRNA-146a and miRNA-200b Antagomirs Accelerate Wound Healing through the Regulation of VEGF
and Fibronectin
sequences of hsa-miR-200b the data were normalized to U6 snRNA [10].
(5’UAAUACUGCCUGGUAAUGAUGAC3’) and
2.5 Real-Time Quantitative PCR
hsa-miR-146a
(5’UGAGAACUGAAUUCCAUGGGUU3’). Tissue samples were homogenized in TRIzol (Life
miRIDIAN™ microRNA antagomir (1.4 µg/wound) Technologies, USA). Total RNA was isolated and
was mixed with the Lipofectamine® Transfection purified following the manufacturer’s instructions as
Reagent (Life Technologies, Carlsbad, CA, USA) [10]. previously described in Ref. [14]. RT was done by
The wounds were treated only once with transfection using commercial kit from Life Technologies. Real
reagent or miR-200b inhibitor (antagomir) in time RT-PCR for mRNAs was carried out in the
transfection reagent, or miR-146a inhibitor in LightCyclerTM (Roche Diagnostics, USA). The data
transfection reagent or combination of both in a total was normalized to the housekeeping gene β-actin.
volume of 10 uL shortly after wounding. The These methods have previously been described [16].
concentrations are based on the data generated from
2.6 ELISA
our previous studied [10]. In such studies, we found
that 100 nmol antagomirs gives optimal effects. Hence VEGF ELISA for cells and mouse tissues were
we used such dosage. performed using a commercially available kit for
human and mouse VEGF (ALPCO, Salem, NH, USA;
2.3 Cell Culture
R&D Systems, Minneapolis, MN, USA) according to
Dermal-derived HMVECs (human microvascular the manufacturer’s instructions [12]. For human FN
endothelial cells) were obtained from Lonza protein detection, ELISA kit was purchased from
(Walkersville, MD). HMVECs were grown in Millipore (Billerica, MA, USA) and for mouse FN,
endothelial cell basal medium 2 (EBM-2, Lonza, ELISA kit was purchased from Kamiya Biomedical
Walkersville, MD) containing hEGF (human Company (WA, USA). For mouse Col 1α1 and p300
epidermal growth factor), 1‰; hydrocortisone, 0.4‰; protein detection, ELISA kits were purchased from
gentamycin, 1‰; FBS (fetal bovine serum), 10%; USUN Life Science Inc., (TX, USA). The assays were
VEGF, 1‰; human basic fibroblast growth factor, 4‰; performed according to the manufacturer’s
long R3 insulin-like growth factor, 1‰; ascorbic acid, instructions.
1‰.
2.7 Migration and Tube Formation Assays
2.4 miRNA Analysis
For wounding (migration) experiments in vitro,
RNA was extracted with the mirVana™ miRNA HMVEC cells were cultured and grown in 6-well plates.
Isolation Kit (Ambion Austin, TX, USA). Total RNA The cells were starved for 24 hours before
(100 ng) was used for cDNA synthesis with TaqMan® experiments, medium was removed and cells were
microRNA Assay Reverse Transcription Primer and rinsed with 1% FCS-medium once. The monolayer
MultiScribeTM reverse transcriptase (Life was artificially injured by scratching across the plate
Technologies Inc., NY, USA). Specific primers were with a pipette tip (approximately 1.3-mm width). The
custom synthesized based on the mature miR-200b wells were washed two times with 1% FCS-medium
and miR-146a sequences (please see above), and to remove detached cells or debris. To examine
real-time quantitative RT-PCR was performed with treatment effects, then the cells were transfected with
TaqMan® microRNA Assay using the LightCycler miR-146a antagomir (100 nM), miR-200b antagomir
(Roche Diagnostic, Laval, Canada) as described and (100 nM), or both combined and cultured with 1%
miRNA-146a and miRNA-200b Antagomirs Accelerate Wound Healing through the Regulation of VEGF 107
and Fibronectin
FCS-medium for 24 hours. After 24 hours, images of FN in mRNA level and protein levels (Fig. 1).
the scratched areas under each condition were Furthermore tube formations of the endothelial cells
photographed. The cells were then collected for were pronounced following transfection with
protein analysis. miR-200b antagomir or both antagomir in
An in vitro tube formation assay kit (Chemicon, combination (Fig. 1).
Billerica, MA) was used to evaluate tube formation of Furthermore, to test the interaction between
HMVECs, subjected to various conditions. Tube miRNAs and their specific target gene, we carried out
formation was assessed using a Leica Microsystems luciferase assay as described [16]. The plasmids
(Bannockburn, IL) inverted microscope [10]. containing luciferase reporter and the target gene
3’-UTR were constructed as described in methods.
2.8 Histological Assessment/CD31
The results are similar to our previous report [10, 16],
Immunocytochemistry
showed miR-146a binds with FN, and miR-200b with
Formalin fixed tissue were embedded in paraffin. VEGF (Data not shown).
The sections were stained with hematoxylin, eosin.
3.2 Antagomirs Accelerate Wound Repair
Immunocytochemical stains for CD31 were performed
using, rat anti-mouse CD31 antibodies (Invitrogen We then monitored the role of miR-146a and
Canada) and analyzed microscopically. miR-200b in wound healing both in non diabetic and
2.9 Statistical Analysis diabetic mice. Wound closure was monitored over a
7-day period. Both normal and diabetic animals
All experimental data are expressed as mean ±SEM displayed a marked increase in the rate of wound
and were analyzed by ANOVA followed by Student’s closure when treated with antagomirs (Figs. 2 and 3).
t-test with or without Bonferroni corrections. Wound areas in the normal mice were decreased to
Differences were considered significant at values of P upto 50%, three days after wounding following
< 0.05. treatment with miR-200b, miR-146a, or both miRNA
3. Results antagomirs combination. Wound closure in
combination group was more pronounced than any
3.1 miRNA Antagonism Increases ECs Migration and
single miRNA antagomir treatment. Wounds in the
Tube Formation
diabetic mice, although demonstrated a delay in
As a proof of principle, initially we studied whether closure, i.e., around 7 days, the decrease was more
miRNA inhibitors have possible roles in wound pronounced in the combination group.
healing in vitro. To this extent, we examined whether
3.3 Mechanism of Antagomirs Mediated Wound
specific miR antagomir may change properties and
Healing
expression of specific endothelial cells proteins which
are of importance in wound healing. To study the mechanism of miRNA antagomirs on
We used scratch assay using HMVEC. When they wound repair, one day after wound induction samples
were transfected with miRNA antagomirs, i.e. single were removed from the wound area to test miRNA
miRNA antagomir or in combination, the cells moved level and to evaluate mRNA expression of VEGF, FN
faster than reagent control (Fig. 1). Dual transfection and Col 11, the molecules of importance in wound
produced most pronounced effects. Furthermore, healing one day after wounding, miR-146a and
miR-200b and miR-146a antagomirs transfection miR-200b level were reduced compared to normal
increased expression of their target genes, VEGF and skin. Interestingly, both these miRNA expressions
108 miRNA-146a and miRNA-200b Antagomirs Accelerate Wound Healing through the Regulation of VEGF
and Fibronectin
A) Cont B) 200b(A) C) 146a (A) D) 146a (A)+200bA)
A NG+Rea gent 24hrs
1 0.83 0.75 0.65
E) Cont F) 200b(A) G) 146a(A) H) 146a (A)+200bA)
I J K L
Relative VEGF protein level
8.0 4.0 1.5 * 2.5
*
Relative FN protein level
* *
2.0
6.0 3.0
1.0
VEGF : β-actin
FN : β-actin
1.5
4.0 2.0
1.0
0.5
2.0 1.0 0.5
0.0 0.0 0.0 0.0
Cont 200b(A) Cont 200b(A) Cont 146a(A) Cont 146a(A)
Fig. 1 Transfection of antagomirs (A) resulted in increased ability of endothelial cells [A-D] to migrate, [E-H] to
differentiate into tubes and [G-J] to augmented mRNA and protein expression of their target genes (VEGF and FN for
antagomirs of miR-200b [200b(A)] and miR-146a [146a(A)], respectively) compared to transfection reagent treated controls
(cont). (Lines represent the distance between wound edges for better visualization, mRNAs levels are expressed as a ratio to
house-keeping gene β-actin to account for differences in reverse transcription efficiencies and amount of template in the
reaction, *P < 0.05 vs. other group).
were also decreased following treatment with antagonism and in the dual antagomir treatment
antagomirs (Fig. 4). VEGF mRNA was significantly groups (Fig. 4). We further histologically examined
increased in miR-200b angtaomir treated group and in the tissue and measured protein levels of several of
combined miRNA antagomirs group, compared to these transcripts which paralleled mRNA levels. (Figs.
controls. Similarly FN expressions were significantly 5 and 6)
increased following treatment with miR-146a
3.4 Antagomirs Cause Histological Changes in the
antagomir or combined miRNAs antagomirs.
Wound
Interestingly, Col 11 mRNA expression was also
increased in the combination group (Fig. 4). To have a To examine histologic changes, we performed H/E
better understanding of the mechanisms causing stains. The results are shown in Fig. 5. Histology of
changes in such multiple transcripts, we examined the transfection reagent applied wound showed loose
transcription co-activator p300 expression. We have connective tissue formation (Figs. 5A and 5B).
previously shown that miR-200b regulates p300 Histology of the combined miR-146a and miR-200b
expression and p300 regulates miR-146a mRNA antagomir treated wounds showed improved healing
expression [10, 16]. As predicted, high p300 and increased number of endothelial cells as
expressions were seen following miR-200b demonstrated by CD31 stain.
miRNA-146a and miRNA-200b Antagomirs Accelerate Wound Healing through the Regulation of VEGF 109
and Fibronectin
Fig. 2 Accelerated wound healing by antagomirs. (A-D) Photographs of punch wounds in the back of mice which were
treated once with either 10 uL of transfection reagent (R) or miR-146a antagomir [146a(A)] or miR-200b antagomir [200b(A)]
or both [a + b(A)]. Please note accelerated healing, which was most pronounced when a combination of antagomirs were used.
(E, F) Morphometric analyses of wound area was showed significant (*) reduction after 3 days. (n = 4-5/group at each time
point, Data are expressed as mean + SD, *P < 0.05 vs. control).
Fig. 3 Accelerated wound healing by antagomirs in the diabetic mice. A-C) Photographs of punch wounds in the back of
diabetic mice which were treated once with either 10 uL of transfection reagent (R) or miR-146a antagomir [146a(A)] or
miR-200b antagomir [200b(A)] or both [a+b(A)], showed accelerated healing, which was most pronounced when a
combination of antagomirs were used. D, E) Morphometric analyses of wound area showed significant (*) reduction after 7
days. (n = 4-5/group at each time point, Data are expressed as mean+ SD, *P < 0.05 vs. controls).
110 miRNA-146a and miRNA-200b Antagomirs Accelerate Wound Healing through the Regulation of VEGF
and Fibronectin
Fig. 4 One day following wounding, miRNA analyses from the wound tissue showed reduced that miR-200b (A) and
miR-146a expression (B); mRNA analyses from the wound tissue showed miR-200b antagomir [200b(A)] increased VEGF
expression (C) and miR-146a antagomir [146a(A)] increased fibronectin (FN) expression (D), which was further pronounced
by combining it with miR-146a antagomir, miR-200b antagomir [a+b(A)]; Similar changes were also seen in E) Col 11 and
F) p300 mRNA expression which was prevented by miR-200b antagomir [200b(A)] and combined miR-146a antagomir,
miR-200b antagomir [a+b(A)], but not by miR-146a antagomir [146a(A)] (NS = normal skin, Cont = transfection reagent
control, S = scrambled antagomir; miRNAs expressions were expressed as a ratio of U6 and mRNAs expressions as a ratio to
housekeeping gene (β-actin) to account for differences in reverse transcription efficiencies and amount of template in the
reaction * = significantly different from other groups, n = 4-5/group).
Fig. 5 Photomicrographs showing the wound area (H/E stain, original magnification X100) from a wound treated with
vehicle (A) and with Combined miR-146a and miR-200b antagomirs (B). Lower right insets show enlarged view of the area
denoted by the box (note the loose connective tissue in (A). Upper left insets show CD31 immunostain of the same area (note
increased endothelial proliferation in B).
miRNA-146a and miRNA-200b Antagomirs Accelerate Wound Healing through the Regulation of VEGF 111
and Fibronectin
Fig. 6 One day following wounding, protein analyses from the wound tissue showed miR-200b antagomir [200b(A)] induced
increased VEGF expression (A) and miR-146a antagomir [146a(A)] induced increased fibronectin (FN) expression (B). Such
increases were further pronounced by combining miR-146a antagomir and miR-200b antagomir [a+b(A)]; similar changes
were also seen in Col 11 (C). (D) miR-200b antagomir [200b(A)], but not miR-146a antagomir [146a(A)] increased p300
protein expression, (n = 4-5/group; *= significantly different from other groups).
endothelial cells and fibroblasts. As wound healing
4. Discussion
requires both neovascularization and increased ECM
Wound healing is a complex process that progresses matrix formation, we used antagonists of these
through the molecular events of cell recruitment, cell miRNAs to promote such process. Compared to
proliferation, extracellular matrix deposition and normal skin, in the wound base levels of these miRs
remodeling [17]. In this research we have were low. Furthermore, in diabetic condition, we have
demonstrated that treatment with specific antagomirs, demonstrated reductions in these miRs [10]. However,
namely miR-146a and miR-200b can significantly we thought that for wound healing we need a forced
accelerate wound healing in the normal and in diabetic reduction of these miRs leading to the increase in the
mice. Furthermore such treatments also demonstrated transcript levels. Interestingly, we further
an additive effect. demonstrated an additive effect of these antagomirs.
We have previously demonstrated that miR-200b Our data are in keeping with previous findings in
and miR-146a negatively regulates VEGF and FN, this area. It has previously been shown that in the
respectively. We have also demonstrated that mimics wound edge endothelial cells, miR-200b regulates
of miR-200b and miR-146a prevent GATA2 (globin transcription factor binding protein 2)
neovascularization and FN production both in vivo and VEGFR2 (VEGF receptor 2) [18]. In keeping
and in vitro, respectively [10, 16]. Wound healing with our previous study, current report also showed
requires participation of multiple cells which include that miR-200b further produces its effects through
112 miRNA-146a and miRNA-200b Antagomirs Accelerate Wound Healing through the Regulation of VEGF
and Fibronectin
regulation of VEGF [10]. It was also noted that fold gene expression for several days following single
changes of mRNA and protein levels of VEGF were application of miRNAs [10, 16]. Furthermore we have
not at the same level. This raises the question of demonstrated an additive effect of these two miRNAs.
additional post translational regulatory mechanism From a therapeutic standpoint, this finding is
which may need specific experiments. On the other significant. In summary, we have demonstrated
hand functional signification was seen as we observed specific miRNA may accelerate skin wound healing in
endothelial proliferation. miR-200b is also known to normal and diabetic condition. These results may have
regulate p300 [10, 19]. Such notion was confirmed in potential therapeutic implications. The limitation of
this study. Transcription co-activator p300 is known the method is that lipofectamine was used to aid the
to control multiple transcription factors and gene transfer of miRNA antagomirs into the cells.
expression [20]. We have also previously shown that Eventhough no toxicity was observed in the given
in endothelial cells and multiple tissues affected by time and condition, the possibility cannot be fully
chronic diabetic complications, FN is regulated by excluded. We also recognize that, there are other
miR-146a [16]. Other researchers have also recently miRNAs, which may also have similar role in this
demonstrated that miR-146a downregulation is a process that requires further studies.
cause of impaired wound healing in diabetes [21]. It 5. Conclusions
has also been hypothesized that abnormal expression
of miR-146a may be one of the factors responsible for The data from this study demonstrated that
the abnormal inflammatory response in the diabetic combination of miR-146a and miR-200b inhibitor
wounds. Interestingly, we also found that other ECM treatment is useful in accelerating wound healing in
proteins e.g. collagen was also modulated by normal and in diabetes. Such process is mediated
antagomirs, especially by miR-200b. Collagen is not a through increased VEGF and FN production.
direct target of miR-200b. However it is possible that Acknowledgments
such regulation occurs through p300 modulation [10,
The research presented in this article was supported
19]. We did not perform detected mechanistic studies
by funds from Canadian Diabetes Association and
to keep this in focus. Some of the mechanisms of the
Heart and Stroke Foundation of Ontario.
specific RNA functions have previously been
demonstrated by us and others [10, 16, 18]. It was References
further noted that these two antagomirs demonstrated [1] W.J. Jeffcoate, K.G. Harding, Diabetic foot ulcers,
an additive effects. Such additive effects have Lancet 361 (2003) 1545-1551.
previously been demonstrated using combined [2] T. Hirsch, M. Spielmann, B. Zuhaili, T. Koehler, M.
Fossum, H-U Steinau, et al., Enhanced susceptibility to
oligonucleotides [22]. Such effects may also be due to
infections in a diabetic wound healing model, BMC Surg.
regulatory roles of miRs on multiple transcripts which 8 (2008) 5.
may interact regulating each other. This concept may [3] S. Guo, L.A. Dipietro, Factors affecting wound healing, J.
Dent. Res. 89 (2010) 219-229.
also explain the prominent effects of combined
[4] W. Filipowicz, S.N. Bhattacharyya, N. Sonenberg,
antagomirs after 7 days compared to day 1. Mechanisms of posttranscriptional regulation by
It is to be noted that we treated the wounds only microRNAs: Are the answers in sight?, Nat. Rev. Genet.
once very early in the process. This approach is based 9 (2008) 102-114.
[5] R. Yi, D. O’Carroll, H.A. Pasolli, Z. Zhang, F.S. Dietrich,
on the hypothesis that several of these changes are
A. Tarakhovsky, et al., Morphogenesis in skin is
initiated very early in the process. We have also governed by discrete sets of differentially expressed
showed that it is possible to successfully modulate microRNAs, Nat. Genet. 38 (2006) 356-362.
miRNA-146a and miRNA-200b Antagomirs Accelerate Wound Healing through the Regulation of VEGF 113
and Fibronectin
[6] R. Yi, M.N. Poy, M. Stoffel, E. Fuchs, A skin microRNA [16] B. Feng, S. Chen, K. McArthur, Y. Wu, S. Sen, Q. Ding,
promotes differentiation by repressing “stemness”, et al., miR-146a-Mediated extracellular matrix protein
Nature 452 (2008) 225-229. production in chronic diabetes complications, Diabetes 60
[7] B.N. Davis, A. Hata, Regulation of microRNA biogenesis: (2011) 2975-2984.
A miRiad of mechanisms, Cell Commun Signal 7 (2009) [17] R.F. Diegelmann, M.C. Evans, Wound healing: An
18-40. overview of acute, fibrotic and delayed healing, Front
[8] K.W. Chang, S.Y. Kao, Y.H. Wu, M.M. Tsai, H.F. Tu, Biosci. 9 (2004) 283-289.
C.J. Liu, et al., Passenger strand miRNA miR-31* [18] Y.C. Chan, S. Roy, S. Khanna, C.K. Sen,
regulates the phenotypes of oral cancer cells by targeting Downregulation of endothelial microRNA-200b supports
RhoA, Oral Oncol. 49 (2013) 27-33. cutaneous wound angiogenesis by desilencing GATA
[9] H. Kawasaki, K. Taira, MicroRNA-196 inhibits HOXB8 binding protein 2 and vascular endothelial growth factor
expression in myeloid differentiation of HL60 cells, receptor 2, Arterioscler. Thromb. Vasc. Biol. 32 (2012)
Nucleic Acids Symp. Ser. 48 (2004) 211-212. 1372-1382.
[10] K. McArthur, B. Feng, Y.X. Wu, S. Chen, S. Chakrabarti, [19] S.T. Mees, W.A. Mardin, C. Wendel, N. Baeumer, E.
MicroRNA-200b regulates vascular endothelial growth Willscher, N. Senninger, et al., EP300—A
factor-mediated alterations in diabetic retinopathy, miRNA-regulated metastasis suppressor gene in ductal
Diabetes 60 (2011) 1314-1323. adenocarcinomas of the pancreas, Int. J. Cancer 126
[11] D. Sayed, M. Abdellatif, MicroRNAs in development and (2010) 114-124.
disease, Physiol. Rev. 91 (2011) 827-887. [20] S. Chen, B. Feng, B. George, R. Chakrabarti, M. Chen, S.
[12] J. Wang, Y. Wang , Y. Wang , Y. Ma , Y. Lan , X. Yang, Chakrabarti, Transcriptional coactivator p300 regulates
Transforming growth factor β-regulated microRNA-29a glucose-induced gene expression in endothelial cells,
promotes angiogenesis through targeting the phosphatase Am. J. Physiol. Endocrinol. Metab. 298 (2010)
and tensin homolog in endothelium, J. Biol. Chem. 288 E127-E137.
(2013) 10418-10426. [21] J. Xu , W. Wu , L. Zhang, W. Dorset-Martin, M.W.
[13] P. Bao, A. Kodra, M. Tomic-Canic, M.S. Golinko, H.P. Morris, M.E. Mitchell, et al., The role of microRNA-146a
Ehrlich, H. Brem, The role of vascular endothelial growth in the pathogenesis of the diabetic wound-healing
factor in wound healing, J. Surg. Res. 153 (2009) impairment: Correction with mesenchymal stem cell
347-358. treatment, Diabetes 61 (2012) 2906-2912.
[14] G.S. Schultz, A. Wysocki, Interactions between [22] T. Oshitari, P. Polewski, M. Chadda, A.F. Li, T. Sato, S.
extracellular matrix and growth factors in wound healing, Roy, Effect of combined antisense oligonucleotides
Wound Repair Regen. 17 (2009)153-162. against high-glucose- and diabetes-induced
[15] K.S. Midwood, L.V. Williams, J.E. Schwarzbauer, Tissue overexpression of extracellular matrix components and
repair and the dynamics of the extracellular matrix, Int. J. increased vascular permeability, Diabetes 55 (2006)
Biochem. Cell Biol. 36 (2004) 1031-1037. 86-92.
