0% found this document useful (0 votes)
15 views5 pages

01 PROVA AUTOR rbpvCB06622 EN

This document reports an atypical case of a dog infected with Babesia bigemina, a parasite typically found in cattle. The dog lived on a cattle farm and showed clinical signs of the disease. Blood analysis and PCR testing confirmed the presence of B. bigemina, representing the first reported case of this parasite in a dog in Mexico. The dog was successfully treated and tested negative after treatment, demonstrating dogs can act as sentinels for livestock parasites.

Uploaded by

jose bravo
Copyright
© © All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as PDF, TXT or read online on Scribd
0% found this document useful (0 votes)
15 views5 pages

01 PROVA AUTOR rbpvCB06622 EN

This document reports an atypical case of a dog infected with Babesia bigemina, a parasite typically found in cattle. The dog lived on a cattle farm and showed clinical signs of the disease. Blood analysis and PCR testing confirmed the presence of B. bigemina, representing the first reported case of this parasite in a dog in Mexico. The dog was successfully treated and tested negative after treatment, demonstrating dogs can act as sentinels for livestock parasites.

Uploaded by

jose bravo
Copyright
© © All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as PDF, TXT or read online on Scribd
You are on page 1/ 5

Short Communication

ISSN 1984-2961 (Electronic)


www.cbpv.org.br/rbpv

An atypical case of Babesia bigemina parasitising a dog


from a rural area of eastern Mexico
Um caso atípico de Babesia bigemina parasitando um cão de uma área rural do
leste do México
José Luis Bravo-Ramos1* ; Sokani Sánchez-Montes2,3; Gerardo Gabriel Ballados-González4;
Dora Romero-Salas1; Jannete Gamboa-Prieto4; Angélica Olivares-Muñoz1

1
Laboratorio de Parasitología, Posta Zootécnica Torreón del Molino, Facultad de Medicina Veterinaria y Zootecnia, Universidad
Veracruzana, Veracruz, México
2
Facultad de Ciencias Biológicas y Agropecuarias, Universidad Veracruzana, Campus Tuxpan, Tuxpan de Rodríguez Cano, Veracruz,
México
3
Centro de Medicina Tropical, Unidad de Investigación en Medicina Experimental, Facultad de Medicina, Universidad Nacional
Autónoma de México, México City, México
4
Laboratorio de Enfermedades Infecciosas, Facultad de Medicina Veterinaria y Zootecnia, Universidad Veracruzana, Veracruz, México

How to cite: Bravo-Ramos JL, Sánchez-Montes S, Ballados-González GG, Romero-Salas D, Gamboa-Prieto J, Olivares-Muñoz A. An
atypical case of Babesia bigemina parasitising a dog from a rural area of eastern Mexico. Braz J Vet Parasitol 2022; 31(3): e006622.
https://doi.org/10.1590/S1984-29612022039

Abstract
A dog that shared habitat with domestic animals in a cattle farm and that was exposed to wildlife was taken to a
private practitioner for clinical examination. The analyses conducted on the patient revealed the presence of Babesia
bigemina by a molecular test. Clinical signs such as lethargy, anorexia and hyperthermia > 39 °C, pale mucous
membranes and blood urine were observed in the patient. The animal was treated with imidocarb dipropionate
(two doses each 0.5 ml/10 kg b.w. at an interval of 14 days). On treatment day 7, the clinical signs were mostly
reduced. On day 30, PCR was carried out to assess the efficacy of the treatment, with a negative result. This case
represents the first report of babesiosis due to B. bigemina in a dog living on a cattle farm in Mexico. It indicates
the lower host specify of these pathogens and that dogs can play a role as sentinels of vector-borne parasites in
livestock animals.
Keywords: Piroplasms, tick-borne disease, phylogenetic analysis, canine babesiosis.

Resumo
Um cão que compartilhava habitat com animais domésticos em uma fazenda de gado e que foi exposto à vida
selvagem foi levado a um clínico particular para exame clínico. As análises realizadas no paciente revelaram a
presença de Babesia bigemina por um teste molecular. Sinais clínicos como letargia, anorexia e hipertermia >
39°C, mucosas pálidas e sangue na urina foram observados no paciente. O animal foi tratado com dipropionato de
imidocarb (duas doses cada 0,5 ml/10 kg de peso corporal em um intervalo de 14 dias). No dia de tratamento 7, os
sinais clínicos foram principalmente reduzidos. No dia 30, foi realizada PCR para avaliar a eficácia do tratamento,
com resultado negativo. Este caso representa o primeiro relato de babesiose por B. bigemina em um cão que vive
em uma fazenda de gado no México. Isso indica que o hospedeiro inferior especifica esses patógenos e que os
cães podem desempenhar um papel como sentinelas de parasitas transmitidos por vetores em animais de criação.
Palavras-chave: Piroplasmas, doença transmitida por carrapatos, análise filogenética, babesiose canina.

Received April 26, 2022. Accepted July 5, 2022.


Financial support: The authors declare that no funds, grants, or other support were received during the preparation of this manuscript.
*Corresponding author: José Luis Bravo-Ramos. E-mail: [email protected]
This is an Open Access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use,
distribution, and reproduction in any medium, provided the original work is properly cited.

Braz J Vet Parasitol 2022; 31(3): e006622 | https://doi.org/10.1590/S1984-29612022039 1/5


An atypical case of Babesia bigemina parasitising a dog

Canine babesiosis is one of the most widespread tick-borne diseases which affects dog populations worldwide.
The disease may cause a multi-organ dysfunction syndrome, which can compromise the life of the host. It is caused
by several species of the protozoan genus Babesia. Based on the size of the intraerythrocytic stages of the parasite,
two main groups have been recognised: the large group (Babesia canis, Babesia rossi and Babesia vogeli) and the small
group (Babesia gibsoni, Babesia conradae, Babesia vulpes and Babesia negevi) (Baneth et al., 2015, 2020; Bawm et al.,
2021). Among them, B. vogeli is most widely distributed in canids throughout the tropical and subtropical regions
(Penzhorn, 2020). It has been postulated that the species of the genus Babesia has been considered as highly specific
for a given host species or group. However, the specificity of these piroplasms is probably lower than expected
(Uilenberg, 2006). Since the implementation of molecular methods, which has increased the sensitivity for the
detection of infectious agents, unusual parasite-host associations have started to be described more frequently in
dogs. Such is the case of piroplasms from livestock and wild artiodactyls (Theileria annulata, Theileria equi, Theileria
sinensis, Theileria velifera and uncharacterized Theileria), which have been reported in dogs from different countries
of the Afrotropical and Oriental regions (Nayyar Ghauri et al., 2019). On the other hand, on cattle farms, canids may
share ectoparasites (that act as vectors of several pathogens) with livestock and wildlife. However, the role of dogs
as sentinels of tick-borne parasites in livestock is not fully understood. Thus, considering the high prevalence of
several tick’s species in canine populations throughout Mexico, it is not surprising to find these shared pathogens
among species of hosts that are infested by the same tick species (Ojeda‐Chi et al., 2019). This report is the first
record of the livestock piroplasm Babesia bigemina infecting a dog. All applicable international, national, and/or
institutional guidelines for the care and use of animals were followed. No approval was required. Anesthesia,
euthanasia, or any other kind of animal sacrifice was not a part of the study. A 4-year-old male mixed-breed dog
that shared habitat with livestock and was exposed to wildlife was taken to a private practice in the municipality of
Jesus Carranza (southern Veracruz, Mexico) with a 1-week history of anorexia, pigmented faeces, pigmenturia, fever
of 40 °C and lethargy. The dog had not travelled outside of the state of Veracruz and had never received a blood
transfusion. After the first physical examination, the dog was evaluated via a baseline assessment consisting on
automatic hematological (XT-4000i, Sysmex), and serum biochemistry analyses (Cobas Integra 400 Plus analyzer).
Then, a screening for vector-borne diseases, using a immunochromatographic test SNAP® 4Dx® Plus followed
by a blood smear stained with Giemsa and observed at 100x. Additionally, ticks on the dog´s body were removed
using forceps, and each one was kept in a small flask with 70% ethanol. Ticks were identified according to the
morphologic characteristics as described elsewhere (Gúzman-Cornejo et al., 2011; Nava et al., 2014). According
to taxonomic keys, we identified the tick species Amblyomma mixtum on the dog (Figure 1a). Blood and serum
analyses revealed anaemia; thrombocytopenia, leucocytosis, eosinophilia, blood urea nitrogen and creatinine
levels were increased (Table 1). The SNAP 4Dx test was negative. However, light microscopy of the blood smear
revealed the presence of pyriform structures inside erythrocytes (Figure 1b). To confirm the identification of
piroplasms, a fragment of the 571-bp region of the 18S ribosomal gene (18S-rDNA) was amplified with the primers

Figure 1. (a) Dorsal view of the female Amblyomma mixtum; (b) Photomicrograph of the paired intra-erythrocytic pyriform
identified on Giemsa-stained thin blood smear suggested as Babesia sp.

Braz J Vet Parasitol 2022; 31(3): e006622 2/5


An atypical case of Babesia bigemina parasitising a dog

BAB01 (5′CCGTGCTAATTGTAGGGCTAATACA3′) and BAB02 (5′GCTTGAAACACTCTARTTTTCTCAAAG 3′) as described


previously (Almeida et al., 2012; Sarma et al., 2019). Genomic DNA was extracted from 100 μL of whole blood
using the QIAampDNA Minikit (Qiagen, Germany). Amplification product were submitted for purification and
sequencing at Macrogen Inc., Korea, and the obtained sequence was deposited in GenBank under accession
number: OM530520. Subsequently, the sequence was compared with those available in GenBank using the Basic
Local Alignment Search Tool (BLASTn tool). The BLAST analysis revealed the highest nucleotide identity (i.e.,100%
and 99.2%) with reference sequences of Babesia bigemina deposited in GenBank (OK605299, MH050387) reported
in cattle and tick Rhipicephalus microplus from China and India. Additionally, sequence generated in this study
and those of other Babesia species deposited in GenBank were aligned using the algorithm MUSCLE in MEGA 11.
Subsequently, a phylogenetic reconstruction using the Maximum likelihood method was performed, also in MEGA
11 (Kumar et al., 2018). Branch support was estimated using 1,000 non-parametric bootstraps. The phylogenetic
analysis supported the finding of B. bigemina. The sequence generated in this work were grouped with those of B.
bigemina in a monophyletic group with support values that varied from 95-100 (Figure 2).

Table 1. Hematological and biochemical analyses in a dog with B. bigemina infection during treatment with imidocard dipropionate.

Parameters Reference value Day 1 Day 20

Hematology RBC × 106 /μL 4.5-7.1 3.2 6.5

White Blood Cells 7.0-10.0 12.2 8.9

Hb g/dl 11.3-15.5 9.2 13.2

Ht (%) 50.2-55.6 48.2 52.2

PLT ×103 /μL 148-450 132.5 146.6

Eosinophils % 0-2 12 1

Eosinophils ×10 /μL3


0-0.8 2.9 0.4

Biochemical Blood Urea Nitrogen 25-30 32 30


(mg/dl)

Creatinine (mg/dl) 0.6-1.2 1.5 1.3

Total bilirubin (μmol/l) 0.0-0.3 1.1 0.3

Figure 2. Maximum-likelihood (ML) phylogenetic reconstruction generated with Tamura-Nei model (TN93). Constructed
phylogenetic tree based on 571 pb of the 18S rDNA gene of genus Babesia. Sequence recovered in this study are marked with
solid figures (red). The numbers at the nodes correspond to bootstrap values higher than 50% obtained with 1000 replicates.
Theileria equi was used as outgroup.

Braz J Vet Parasitol 2022; 31(3): e006622 3/5


An atypical case of Babesia bigemina parasitising a dog

The dog was treated with imidocarb dipropionate (two doses each 0.5 ml/10 kg b.w. at an interval of 14 days,
intramuscularly) and fluid therapy. Additionally, a single dose of a chewable tablet that contained afoxolaner
(2.5-5 mg/kg) and milbemycin oxime (0.5-1 mg/kg) NexGard Spectra ® was given orally. On day 7 of treatment,
clinical signs in this patient were mostly reduced, with a rapid resolution. On day 20, the dog underwent physical
examination. Red blood analysis showed increased values in RBC, Hb and HT compared to day 0, indicating recovery
from anaemia. In day 30, a PCR was carried out again to assess the efficacy of the treatment, and Babesia DNA
was no longer detectable. The treatment showed good tolerance and safety, with scarce adverse events observed.
The case resolved favorably, and the patient was discharged.
In this report, we describe the first record and characterisation of B. bigemina in a dog with clinical and
haematological abnormalities suggestive of Babesia infection in Mexico. Previous records in Mexico have shown
that dogs in rural areas can be infested by several hard tick species such as Amblyomma mixtum, Amblyomma
ovale, Amblyomma parvum, Ixodes affinis, Rhipicephalus microplus, Rhipicephalus sanguineus s.l. and Amblyomma
oblongoguttatum. The tick A. mixtum, detected in this case, is the same as that previously reported attached to dogs
in rural communities in Yucatan (Ojeda‐Chi et al., 2019). Additionally, A. mixtum parasitises a wide range of hosts
and can take advantage of the nutritional resources present in the area (Gúzman-Cornejo et al., 2011). For this
reason, it is likely that this tick can be a potential transmitter of Babesia species and exchanges several pathogens
between domestic animals and wildlife.
One of the main clinical findings observed in canine babesiosis is anaemia. Some reports state that oxidative
stress and lipid peroxidation play a role in the pathogenesis of anaemia in some hemoprotozoan diseases
(Maharana et al., 2016). In biological membranes, these mechanisms induce disturbances of the structural
integrity, leading to the rupture of the membrane and the release of red blood cell contents, which causes lysis
(Holovakha et al., 2018). However, in babesiosis anaemia is caused by multifactorial components, including direct
parasite damage to the erythrocyte membrane, splenic removal of damaged and parasitized erythrocytes, as well
as activation of the immune system such as complement cascade and/or presence of anti-erythrocyte antibodies
(Köster et al., 2015). Other clinical signs of canine babesiosis include fever, anorexia, depression and lethargy
(Crnogaj et al., 2010), which coincide with our case. The abnormalities in the elevation of white blood cells could
be related to the Babesia infection, with the likely exception of the peripheral eosinophilia. However, absolute
eosinophilia cannot be considered a marker of babesiosis, considering that it is not a specific alteration of the
infection in dogs but a common finding secondary to several helminths parasitic or allergic diseases (Chidumayo,
2018). Low platelet count is well described in canine babesiosis as well as in other hemoprotozoan diseases, such
as malaria and trypanosomiasis (Karasová et al., 2022). However, the mechanism of thrombocytopenia seen in
babesiosis is not clear. The severity and rapid recovery of the platelet counts has led to the suggestion that immune-
mediated mechanisms are involved (Rautenbach et al., 2018). Higher serum urea levels are not uncommon in
dogs with babesiosis, and this elevation is often disproportionate to the rise in creatinine levels. This is probably
due to increased protein catabolism and urea production resulting from gastrointestinal haemorrhage or protein
catabolism due to the febrile inflammatory illness (Ullal et al., 2018). Regarding treatment, imidocarb is the one
of the main drugs used in the antiprozoal treatment of babesiosis and has direct action against the parasite DNA,
causing nucleic acid damage and inhibition of cellular repair and replication; however, a few drugs and drug
combinations are used in the treatment of canine babesiosis, often without complete parasite elimination, and
the dogs usually become chronic carriers or present with recurrent episodes of acute infection (Baneth, 2018).
In this new scenario, veterinarians should be aware of unexpected Babesia species in dogs that, as known for this
species, may be even worse than in livestock, considering the rapid manifestation of the clinical signs. In conclusion,
the spectrum of Babesia pathogens that infect dogs is gradually being elucidated with the aid of new molecular
techniques and meticulous clinical investigation. Additionally, chemoprophylaxis should also be adopted for dogs
living in an endemic area, with the primary means of prevention being tick control.

Ethical Approval
All applicable international, national, and/or institutional guidelines for the care and use of animals were followed.
No approval was required. Anesthesia, euthanasia, or any other kind of animal sacrifice was not a part of the stud.

Braz J Vet Parasitol 2022; 31(3): e006622 4/5


An atypical case of Babesia bigemina parasitising a dog

References
Almeida AP, Marcili A, Leite RC, Nieri-Bastos FA, Domingues LN, Martins JR, et al. Coxiella symbiont in the tick Ornithodoros
rostratus (Acari: argasidae). Ticks Tick Borne Dis 2012; 3(4): 203-206. http://dx.doi.org/10.1016/j.ttbdis.2012.02.003. PMid:22480930.
Baneth G, Florin-Christensen M, Cardoso L, Schnittger L. Reclassification of Theileria annae as Babesia vulpes sp. nov. Parasit
Vectors 2015; 8(1): 207. http://dx.doi.org/10.1186/s13071-015-0830-5. PMid:25890372.
Baneth G, Nachum-Biala Y, Birkenheuer AJ, Schreeg ME, Prince H, Florin-Christensen M, et al. A new piroplasmid species infecting
dogs: morphological and molecular characterization and pathogeny of Babesia negevi n. sp. Parasit Vectors 2020; 13(1): 130.
http://dx.doi.org/10.1186/s13071-020-3995-5. PMid:32312309.
Baneth G. Antiprotozoal treatment of canine babesiosis. Vet Parasitol 2018; 254: 58-63. http://dx.doi.org/10.1016/j.
vetpar.2018.03.001. PMid:29657012.
Bawm S, Myaing TT, Thu MJ, Akter S, Htun LL, Win MM, et al. PCR detection and genetic characterization of piroplasms from
dogs in Myanmar, and a possible role of dogs as reservoirs for Theileria parasites infecting cattle, water buffaloes, and goats.
Ticks Tick Borne Dis 2021; 12(4): 101729. http://dx.doi.org/10.1016/j.ttbdis.2021.101729. PMid:33984595.
Chidumayo NN. Epidemiology of canine gastrointestinal helminths in sub-Saharan Africa. Parasit Vectors 2018; 11(1): 100. http://
dx.doi.org/10.1186/s13071-018-2688-9. PMid:29458421.
Crnogaj M, Petlevski R, Mrljak V, Kis I, Torti M, Kucer N, et al. Malondialdehyde levels in serum of dogs infected with Babesia
canis. Vet Med 2010; 55(4): 163-171. http://dx.doi.org/10.17221/77/2010-VETMED.
Guzmán-Cornejo C, Robbins RG, Guglielmone AA, Montiel-Parra G, Pérez TM. The Amblyomma (Acari: Ixodida: Ixodidae) of
Mexico: identification keys, distribution and hosts. Zootaxa 2011; 2998(1): 16-38. http://dx.doi.org/10.11646/zootaxa.2998.1.2.
Holovakha VI, Piddubnуak ОV, Bakhur TI, Vovkotrub NV, Antipov AA, Anfiorova MV, et al. Changes in erythrocytopoesis indices
in dogs with babesiosis. Regul Mech Biosyst 2018; 9(3): 379-383. http://dx.doi.org/10.15421/021856.
Karasová M, Tóthová C, Víchová B, Blaňarová L, Kisková T, Grelová S, et al. Clinical efficacy and safety of Malarone®, azithromycin
and artesunate combination for treatment of Babesia gibsoni in naturally infected dogs. Animals 2022; 12(6): 708. http://dx.doi.
org/10.3390/ani12060708. PMid:35327106.
Köster LS, Lobetti RG, Kelly P. Canine babesiosis: a perspective on clinical complications, biomarkers, and treatment. Vet Med
2015; 6: 119-128. http://dx.doi.org/10.2147/VMRR.S60431. PMid:30155438.
Kumar S, Stecher G, Li M, Knyaz C, Tamura K. MEGA X: molecular evolutionary genetics analysis across computing platforms.
Mol Biol Evol 2018; 35(6): 1547-1549. http://dx.doi.org/10.1093/molbev/msy096. PMid:29722887.
Maharana BR, Tewari AK, Saravanan BC, Sudhakar NR. Important hemoprotozoan diseases of livestock: Challenges in current
diagnostics and therapeutics: an update. Vet World 2016; 9(5): 487-495. http://dx.doi.org/10.14202/vetworld.2016.487-495.
PMid:27284225.
Nava S, Beati L, Labruna MB, Cáceres AG, Mangold AJ, Guglielmone AA. Reassessment of the taxonomic status of Amblyomma
cajennense (Fabricius, 1787) with the description of three new species, Amblyomma tonelliae n. sp., Amblyomma interandinum
n. sp. and Amblyomma patinoi n. sp., and reinstatement of Amblyomma mixtum Koch, 1844, and Amblyomma sculptum Berlese,
1888 (Ixodida: ixodidae). Ticks Tick Borne Dis 2014; 5(3): 252-276. http://dx.doi.org/10.1016/j.ttbdis.2013.11.004. PMid:24556273.
Nayyar Ghauri H, Ijaz M, Farooqi SH, Ali A, Ghaffar A, Saleem S, et al. A comprehensive review on past, present and future aspects
of canine theileriosis. Microb Pathog 2019; 126: 116-122. http://dx.doi.org/10.1016/j.micpath.2018.10.033. PMid:30385396.
Ojeda‐Chi MM, Rodriguez‐Vivas RI, Esteve‐Gasent MD, Pérez de León AA, Modarelli JJ, Villegas‐Perez SL. Ticks infesting dogs in
rural communities of Yucatan, Mexico and molecular diagnosis of rickettsial infection. Transbound Emerg Dis 2019; 66(1): 102-
110. http://dx.doi.org/10.1111/tbed.12990. PMid:30102850.
Penzhorn BL. Don’t let sleeping dogs lie: unravelling the identity and taxonomy of Babesia canis, Babesia rossi and Babesia vogeli.
Parasit Vectors 2020; 13(1): 184. http://dx.doi.org/10.1186/s13071-020-04062-w. PMid:32312292.
Rautenbach Y, Schoeman J, Goddard A. Prevalence of canine Babesia and Ehrlichia co-infection and the predictive value of
haematology. Onderstepoort J Vet Res 2018; 85(1): e1-e5. http://dx.doi.org/10.4102/ojvr.v85i1.1626. PMid:30326715.
Sarma K, Nachum-Biala Y, Kumar M, Baneth G. Molecular investigation of vector-borne parasitic infections in dogs in Northeast
India. Parasit Vectors 2019; 12(1): 122. http://dx.doi.org/10.1186/s13071-019-3389-8. PMid:30909966.
Uilenberg G. Babesia: a historical overview. Vet Parasitol 2006; 138(1-2): 3-10. http://dx.doi.org/10.1016/j.vetpar.2006.01.035.
PMid:16513280.
Ullal T, Birkenheuer A, Vaden S. Azotemia and proteinuria in dogs infected with Babesia gibsoni. J Am Anim Hosp Assoc 2018; 54(3):
156-160. http://dx.doi.org/10.5326/JAAHA-MS-6693. PMid:29558219.

Braz J Vet Parasitol 2022; 31(3): e006622 5/5

You might also like