See discussions, stats, and author profiles for this publication at: https://www.researchgate.

net/publication/305809751

Fumonisin-Producing Fusarium Species Causing Ear Rot of Corn in the

Philippines

Article · May 2016

CITATIONS READS

11 16,790

4 authors, including:

Ana Barcos Julie Aiza L. Mandap

The University of Queensland University of the Philippines Los Baños
4 PUBLICATIONS 16 CITATIONS 2 PUBLICATIONS 11 CITATIONS

SEE PROFILE SEE PROFILE

Eureka Ocampo
University of the Philippines Los Baños
22 PUBLICATIONS 125 CITATIONS

SEE PROFILE

Some of the authors of this publication are also working on these related projects:

Enhancing Competitiveness of Philippine 'Carabao' Mango through Varietal Improvement Program View project

Development of Molecular Markers for the Assessment of Moisture Stress Tolerance in Eggplant. Phase 2 View project

All content following this page was uploaded by Ana Barcos on 04 August 2016.

The user has requested enhancement of the downloaded file.

Philippine Journal of Crop Science (PJCS) April 2016, 41 (1):12-21
Copyright 2016, Crop Science Society of the Philippines Full Paper

Fumonisin-Producing Fusarium Species Causing Ear Rot of Corn in the

Philippines
Cecilia B. Pascual*, Ana Kristine S. Barcos, Julie Aiza L. Mandap and Eureka Teresa M. Ocampo

Crop Science Cluster, College of Agriculture, University of the Philippines Los Baños, 4031 College, Laguna,
Philippines; *Corresponding author, [email protected]

A wide occurrence of corn ear rot caused by Fusarium species has been observed in the last
few years in many corn-growing areas in the Philippines. The disease caused by Fusarium
species produces fumonisins, a family of mycotoxins causing fatal diseases in animals and
human. No local studies on Fusarium ear rot of corn contaminated with fumonisins have been
done. Hence, this study was conducted to identify Fusarium infecting corn in different corn-
growing regions by conventional and molecular methods and to determine accurately the
Fusarium isolates producing fumonisins using specific primers by polymerase chain reaction
(PCR) assay and by enzyme-linked immunosorbent assay (ELISA) test. Three hundred isolates
of Fusarium were extracted into pure culture from the collections in various corn-growing
regions in the Philippines. The isolates were characterized based on morphological traits, ELISA
test and PCR assay. F. verticillioides was the predominant Fusarium species that produced
fumonisin observed in the corn-growing areas of the Philippines. Also observed were one
F. proliferatum isolate and three F. graminearum isolates. Twenty out of the 254 F. verticillioides
isolates collected were non-producers of fumonisins. These findings are very important to come
up for a more stable resistance to Fusarium ear rot in corn breeding in the Philippines.
Information generated from this study can be used to manage the risk of fumonisin
contamination on corn grains after harvest.

Keywords: corn ear rot, fumonisins, Fusarium species, Fusarium verticillioides

INTRODUCTION
Fusarium verticillioides (Sacc.) synonym F. seeds, through wounds created by insects and/or
moniliforme Sheldon (teleomorph: Gibberella through infection of the silks (Leslie and Summerell
moniliformis) causes Fusarium ear rot in corn as well 2006). F. verticillioides infection is characterized by
as stalk rot worldwide (Munkvold et al. 1997). It can whitish pink to lavender discoloration on kernels and/
contaminate the grains with fumonisins, a family of or silk and white streaks radiating from the point of
mycotoxins that affect animal and human health silk attachment at the cap of the kernel known as the
(Marasas et al. 1984; Logrieco et al. 1990). “starburst” symptom. Fumonisin B1 and Fumonisin
Fumonisins can cause esophageal cancer and neural B2 are produced by F. verticillioides during its
tube birth defects in humans, and equine biotrophic endophytic association with corn, as well
leukoencephalomalacia and porcine pulmonary as during its saprophytic growth (Bacon et al. 2001).
edema in animals. F. verticillioides is a major causal High humidity and temperatures, and drought before
agent of symptomless infection of corn ear, in which or during flowering promote high levels of Fusarium
fumonisins can also be present although usually at ear rot infection and fumonisin contamination. Aside
low levels (Desjardins and Plattner 1998). Symptom- from F. verticillioides, other species known to cause
less infection of corn associated with fumonisins ear rots are F. graminearum, F. proliferatum,
occurs even where the extreme environments F. oxysporum, F. thapsinum and F. subglutinans
associated with ear rot are less prevalent (Munkvold (Rahjoo et al. 2008; Gherbawy et al. 2002).
et al. 1997). Fumonisins can be detected in a variety
of processed and unprocessed grain products High heterogeneity of the Fusarium species renders
(Bullerman 1996). Thus, they are a concern for both classification based on morphological characteristics
animal and human consumers of corn, especially in difficult. Moreover, phenotypic features, can be easily
developing countries (Thiel 1998) and in population influenced by temperature and the type of media
segments where corn is a major part of the diet. The used (Gherbawy et al. 2002). Molecular tools
incidence and severity of Fusarium ear mold and accurately and rapidly identify pathogens including
fumonisin in corn varies widely with growing season, Fusarium down to species level (Shapira et al. 1996;
location, and genotype (Bullerman 1996). Nyaka 2010), and are also useful for assessing
genetic relationship in F. verticillioides strains
F. verticillioides is a soil- and seed-borne facultative collected from different geographical locations.
endophyte characterized by pink and purple mycelia. Mycotoxins are also detected using enzyme-linked
The pathogen can enter corn systemically from immunosorbent (ELISA) kits.

CB Pascual et al.
The widespread occurrence of ear rots in major corn
production areas in the Philippines is alarming enough
to warrant further study on the rapid detection and
development of proper control measure. Foods and
feeds, especially in warm climates like that of the
Philippines, are susceptible to invasion by mycotoxins
during preharvesting and processing caused by
Fusarium, Gibberella and Aspergillus species (Abbas
et al. 1988; Marasas et al. 1979; Miller 1994; Logrieco
et al. 1990). This is a cause for concern since
fumonisins have also been detected in infected yet
symptomless corn kernels (Bullerman et al. 1994;
Munkvold et al. 1997).

In 2007 wet season at the Institute of Plant Breeding,

at the University of the Philippines Los Baños, 35% of
corn ears harvested were infected with Fusarium ear
rot in which the degree of infection ranged from 5-60%
at harvest. Observation on incidence in different
corn-growing regions of the country is increasing in the
past few years. However, few studies were done to
investigate the identity and management of the toxin-
producing Fusarium species in corn in the Philippines.
Cumagun et al. (2009) identified F. verticillioides,
collected from Isabela and Laguna, to cause Fusarium
ear rot. Hence, this study was conducted to generate
Figure 1. Geographical representation of the
information on the identity, genetic variability and
collection sites in the Philippines
fumonisin production of the Fusarium ear rot isolates
in corn-producing regions of Luzon, Visayas and
Mindanao using traditional taxonomic characterization, fungal growth. Single conidia were transferred to new
polymerase chain reaction (PCR) and ELISA indexing plates for further analysis. A total of 494 isolates were
assays. recovered from the ear rot samples collected from the
different geographic regions.
MATERIALS AND METHODS
Morphological Characterization of Fusarium spp.
Collection and Isolation of Fusarium species Cultural characters were assessed by direct and
A total of 25 corn fields in 17 major corn growing microscopic examination. The colony morphology,
provinces with varying climatic conditions in the density, pigmentation, arrangement of conidia and
Philippines (Figure 1) were sampled from October conidiophores, presence/absence of chlamydospores,
2011 to March 2013. The average annual temperature macroconidia and microconidia, septation and
during the collection period was 27-28°C, with highest formation of clusters and chains were observed in the
temperatures of 33°C and 35°C in 2012 and 2013, cultures growing on PDA. Morphological characteriza-
respectively. The average annual temperature in 2013 tion of the isolates was conducted following the
was the highest recorded since 2003. Relative Fusarium Laboratory Manual Leslie and Summerell
humidity in 2013 ranged 75-80%, while average (2006).
relative humidity was less than 70% in 2012. In 2012,
the dry months were April and May, with precipitation Identification of Isolates using Species-Specific
peaks within August to October. Low levels of PCR Assay
precipitation were observed for the rest of the 2012 up
to August 2013. DNA Extraction. DNA was extracted from fungal
mycelia using the method of Tsai and Olson (1991)
Infected corn ear samples were collected and pooled with modifications. Fungal mycelia from 3-4 d old
during harvest per site. Infected kernels and healthy cultures were scraped using a sterile scalpel and
kernels around the infected ones were aseptically placed in 1.5 mL microcentrifuge tubes with distilled
selected. Isolation into pure culture and identification water. Mycelia were pelleted by centrifugation at
of Fusarium species. were done following standard 10,000 rpm for 10 min. The pellet was thoroughly
protocols (Bensch 1995). Symptomatic and homogenized with sterile mortar and pestle in 500 µL
asymptomatic corn seeds from infected ears were of extraction buffer (0.1 M NaCl, 0.5 M Tris-HCl and
surface sterilized with 10% hypochlorite solution for 5 5% SDS). Homogenate was placed in 1.5 mL micro-
min followed by washing three times with sterile centrifuge tube and centrifuged at 10,000 rpm for 10
distilled water. Seeds were blot-dried on sterile paper min. The supernatant was transferred to new tubes,
towels, then plated onto previously prepared potato mixed with equal volume of phenol:chlorofrom:isoamyl
dextrose agar (PDA) medium. After incubation at 27°C alcohol (24:1:1) followed by mixing by gentle inversion.
in the dark for 5-7 d, the plates were observed for After centrifugation at 10,000 rpm for 5 min, the clear

Fumonisin-producing Fusarium species 13

Table 1. Oligonucleotide primers used for species-specific detection of Fusarium isolates
Species-specificity Primer Name Primer Sequence (5’-3’) Product Size Reference
F. verticillioides VERT1 GTCAGAATCCATGCCAGAACG
800 bp Patiño et al. 2004
VERT2 CACCCGCAGCAATCCATCAG
F. graminearum Fg16F CTCCGGATATGTTGCGTCAA
280 bp Nicholson et al. 1998
Fg16R GGTAGGTATCCGACATGGCAA
F. proliferatum VERF TGTCAGTAACTCGACGTTGTTG
420 bp Mulé et al. 2004
VERR CTTCCTGCGATGTTTCTCC
Fumonisin F-VERT 1 GCGGGAATTCAAAAGTGCC
400 bp Patiño et al. 2004
F-VERT 2 GAGGGCGCGAAACGGATCGG

RAPD M13 GAGGGTGGCGGTTCT - O’Donnell et al. 1999

aqueous phase was transferred to a new 1.5 mL tube Quantification of Mycotoxin by Enzyme-linked
and gently mixed with 2.5x volume of isopropanol Immunosorbent Assay (ELISA). Total fumonisins
alcohol. One hour after overnight incubation at 4°C, (FB1+FB2+FB3) were quantified using fumonisin
tubes were centrifuged at 10,000 rpm for 10 min. ELISA kits (Diagnostic Automation, Inc.) following the
Supernatant was discarded and DNA pellet was manufacturer’s protocol and based on the protocol of
washed twice with 70% ethanol, air-dried and Afoabi et al. (2007). All fungal isolates from seed lots
resuspended in Tris-EDTA buffer. of symptomatic and asymptomatic grains were
analyzed. The subsamples consisting of five 100-g
Species-Specific PCR Assay. Genomic DNA of corn grains were pooled, and a single 200-g compo-
F. verticillioides was amplified using Vert1 and Vert2 site sample of corn kernels was ground to 50 mesh
primers (Patiño et al. 2004). For rapid detection of using a laboratory mill. Ground samples were kept
fumonisin producing isolates, F-Vert-1 and F-Vert-2 at -20°C, and then analyzed for fungi and mycotoxin
primers were used (Patiño et al. 2004). Isolates production. Diethylpyrocarbonate (DEPC) water was
detected to produce fumonisins but not identified as F. used as the negative control. No positive control was
verticillioides were assayed using primers specific for used since the ELISA fumonisin detection kit was used
F. graminearum and F. proliferatum (Table 1). for detection of fumonisin levels of each isolate.
Amplification reactions were performed in MyCycler
Thermal Cycler (Bio-Rad Laboratories Inc.). The RESULTS
reaction volume of 15 µL contained 1x PCR buffer,
2.5 mM MgCl2, 0.2 mM dNTPs, 0.2 mM of the forward Morphological and Cultural Characteristics
and reverse primers, 1U Taq DNA Polymerase From the total 494 ear rot-infected samples collected,
(DuroTaq) and DEPC water. Amplification was done 300 isolates were ascertained as Fusarium spp. based
following the optimized PCR conditions: initial on morphological and cultural characters. Predominant
denaturation at 94°C for 3 min; 35 cycles of phenotypic observation of the isolates cultivated on
denaturation at 94°C for 1 min, annealing at 50°C for 1 PDA corresponded to the key characters of
min, and extension at 72°C for 2 min. Final extension F. verticillioides presented by Leslie and Summerell
was at 72°C for 5 min (1 cycle). (2006). Initially, cultures have white mycelia but may
develop pink to violet pigments with age (Figure 2A).
M13 Fingerprinting. Amplification reactions were F. verticillioides microconidia may form in long chains
performed in 15 µL reaction volume containing 1x and clusters (Figure 2B). Microconidia are oval to
PCR buffer, 1.5 mM MgCl2, 0.2 mM dNTPs, 1 mM of club-shaped with a flattened base and 0-septate borne
the primer, 2 U Taq DNA Polymerase (DuroTaq) and from monophialides that may occur in V-shaped pairs
DEPC water. PCR was carried out using single primer, to give a rabbit ear appearance (Figure 2C).
M13 following the temperature profile: initial Macroconidia were also observed but were few and
denaturation, followed by the 30 cycles of denaturation difficult to find. Chlamydospores are not produced, but
at 94°C for 1 min; annealing at 50°C for 1 min; swollen cells in the hyphae may be mistaken for
extension at 72 °C for 2 min. The final extension was chlamydospores or pseudochlamydospores.
72°C for 10 min. The DNA fragments were separated
by electrophoresis on a 1.5% agarose gel in 0.5x TAE Few other isolates exhibited different phenotypic
buffer (20 mM Tris, 10 mM acetic acid, 0.5 mM EDTA, characters which correspond to the specifications of
pH 8.4, and stained with GelRed (Biotium Inc.). All other species, such as F. graminearum and
visual bands were counted and data were scored as 0 F. proliferatum. The F. graminearum cultures grew
and 1 for absence and presence of amplicons rapidly and produced relatively large amounts of
respectively. Reproducibility was confirmed by dense mycelia that varied from white to pale orange to
repeating the PCR for at least two times. yellow in color and also produced red pigments in

14 CB Pascual et al.
Figure 2. Cultural and morphological characteristics of Fusarium verticillioides (A-C): A) on PDA B) microconidia in chains
and clusters and C) microconidia formed from monophialides; F. graminearum (D-F): D) on PDA E) macroconidia
with foot-shaped basal cell and F) 5-6 septated macroconidia; F. proliferatum (G-I): G) on PDA H) microconidia in
chains borne in monophialides/polyphialides and I) 3-5 septated macroconidia

media. The pigment was pH sensitive and showed Microconidia are club-shaped with a flattened base
changes from red to yellow as the pH dropped which may form in chains, and less common in false
(Figure 2D). Morphological characteristics include heads from monophialides and polyphialides (Figure
macroconidia which are relatively slender, sickle- 2H). Macroconidia are slender, almost straight and
shaped to almost straight, with 5-6 septate, a tapered usually have 3-5 septate (Figure 2I). Distinguishing
apical cell and a distinctly foot-shaped basal cell characters of F. proliferatum to F. verticillioides are the
(Figures 2E and 2F). Chlamydospores formation extensive proliferation of the polyphialides and the
varied and was often formed in macroconidia. shorter length of microconidial chains.
Microconidia were absent.
Identification of Fusarium Species and Detection
Cultures of F. proliferatum had initially white abundant of Fumonisin-Producing Fusarium
aerial mycelium which may become purple-violet with Figure 3 shows expected PCR products using the
age (Figure 2G). Violet pigments usually are produced different primers for identifying F. verticillioidies,
in the media, but with overall pigmentation varying in fumonisin-producing isolates and other strains that are
intensity, from nearly colorless to almost black. not F. verticillioides. PCR products of 800 bp from

Fumonisin-producing Fusarium species 15

Table 2. Number of isolates identified as Fusarium verticillioides, F. proliferatum, F. graminearum and the corresponding
count of fumonisin-producing isolates from various sites in the Philippines
Total Fusarium Fumonisin
Sites F. verticillioides F. proliferatum F. graminearum
Collection spp.* (+)
Batangas 44 31 0 0 1 26
Bohol 12 4 1 0 0 4
Bukidnon 11 7 0 1 2 8
Camarines Sur 8 1 0 0 0 1
Cebu 59 1 0 0 1 2
General Santos 88 49 0 1 6 45
Ilocos Norte 7 0 0 0 0 0
Ilocos Sur 73 59 0 1 4 49
Isabela 32 20 0 0 5 17
Laguna 80 57 0 0 13 59
La Union 3 1 0 0 0 1
Pangasinan 8 3 0 0 5 6
Quezon 10 5 0 0 1 3
Quirino 6 0 0 0 0 0
Saranggani 16 0 0 0 0 0
South Cotabato 31 17 0 0 1 11
Tarlac 6 3 0 0 0 2
Total 494 258 1 3 42 234
*Fusarium isolates not identified as F. verticillioides, F. proliferatum or F. graminearum.

primers VERT1 and VERT2 identify the F. Genetic Diversity of Fusarium species Causing
verticillioides strains. From the 494 Fusarium isolates Corn Ear Rot in the Philippines
assayed, 86% were F. verticillioides with the most The primer M13 produced a considerable number of
number of isolates originating from Ilocos Sur (59 amplified products which can be used as comparison
isolates) followed by Laguna (57), General Santos for a genetic diversity study. The DNA band sizes of
(49), Batangas (31), Isabela (20) and South Cotabato the isolates from Luzon, Visayas and Mindanao varied
(17) (Table 2). The least number of F. verticillioides from 400-3000 bp. The representative isolates were
isolates were from Bukidnon (7), Quezon (5), Bohol (4) comprised of nine fumonisin-producing F. verticil-
Pangasinan and Tarlac (3), and only 1 isolate from lioides, one non-fumonisin producing F. verticillioides,
Camarines Sur, Cebu and La Union (Table 2). The eight fumonisin producing Fusarium spp. which
ability of these isolates to produce fumonisin was also include four isolates of F. graminearum and one F.
assessed using fumonisin-specific primer pair proliferatum, and one non-fumonisin producing and
(F-VERT 1 and F-VERT 2) derived from DNA non-F. verticillioides isolate. The presence of a 400 bp
sequences of fumonisin-producing Fusarium (Figure fragment was observed in almost all of the isolates
3). Results indicate that 234 of 494 (78%) of the tested except for one (248C-1). Interestingly, this isolate from
isolates produce fumonisin. Isabela was tested negative for F. verticillioides
(Figure 5).
The remaining 70 of 494 (14%) of the isolates not
identified as F. verticillioides but detected to produce The DNA fingerprints shown in Figure 5 was used to
fumonisins were assayed using primers Fg16F/R and cluster the 19 isolates to two major clusters
VERF/R specific for F. graminearum and F. distinguished at a similarity distance of 63%. The
proliferatum, respectively. Lane 1 showed the first major cluster separated to two subgroups (Ia and
expected product size (800 bp) for F. verticillioides Ib), the first one consisted of two isolates with 84%
(Figure 4). The genomic DNA used in Lanes 2-10 are similarity (Figure 6). The isolates (248C5 and 92C)
from isolates that produced fumonisin, but were not were collected from Isabela and General Santos;
F. verticillioides. No amplification products were regardless of its geographical location these two
observed in Isolates 248C1, 246C1, 16, 126 and isolates shared a high percentage of relatedness.
248C5 whereas Isolates 92C, 228A, 214E4 and 237C
showed amplification products of 280 bp, which is the The second major cluster is composed of 6 isolates
expected product size of F. graminearum (Figure 4). which exhibited 65% similarity. A separation into two
Only isolate 63 was identified as F. proliferatum with subgroups (IIa and IIb) was distinctly observed in this
expected product size of 420 bp. F. graminearum cluster (Figure 6). Subgroup IIa consists of 3 isolates
isolates were from General Santos (92C), Bukidnon from La Union, Isabela and Camarines Sur with 100%
(228A), Ilocos Sur (214E4) and Cebu (237C) whereas similarity between them. Subgroup IIb consisting of
F. proliferatum was from Bohol (63) (Table 2). isolates 248D-4 and 217A-1 from Isabela and Ilocos
Identification of F. graminearum and F. proliferatum by Sur exhibited 73% similarity. The isolates from Cebu
PCR assay supports the morphological and cultural were distinct in their genotype compared to the others
characters observed on PDA medium. having only 21% in similarity. However, isolates from
La Union, Isabela, Camarines Sur and General Santos
showed 100% similarity.
16 CB Pascual et al.
Figure 3. Agarose gel electrophoresis of products from PCR assay using VERT 1/2 and F-VERT 1/F-VERT2. Lane
M:molecular marker 1kb+ Ladder (Invitrogen, USA); Lane NC: negative check (water); Lanes 1-11: F. verticillioides
isolates 143, 118B1, 118B2, 166, 132, 63, 78, 100A, 105B, 82B, and 127A2 (800 bp); Lanes 12-18: fumonisin-
producing F. verticillioides isolates 127A1, 173A, 77, 103, 211B1, 60, and 211A (400 bp)

Figure 4. Agarose gel electrophoresis of products from PCR assay using VERT1/2 (for F. verticillioides), Fg16F/R (for F.
graminearum) and VERF/R (for F. proliferatum) primers. Lane M: molecular marker 1 kb plus ladder (Invitrogen,
USA); Lane NC: negative check; Lane 1: F. verticillioides isolate 185A; Lanes 2-5:non-F. verticillioides isolates
248C1, 246C1, 15, 126 and 248C5; Lanes 6-9: F. graminearum isolates 16C, 92C, 228A, 214E4 and 237C
(280bp); Lane 10: F. proliferatum isolate 63 (420 bp)

Figure 5. Agarose gel electrophoresis of DNA amplification products from PCR assay using M13 primer. Lane M: molecular
marker 1 kb+ ladder (Invitrogen, USA); Lane NC: negative check; Lane 1-19: Fusarium isolates 185A, 248C1,
2471A1, 248D1, 248D4, 249A1, 22B, 16, 217A1, 231C, 126, 248C5, 248C1, 92C, 228A, 214D2, 63, 2143E, 237C

Fumonisin-producing Fusarium species 17

Table 3. PCR and ELISA results for F. verticillioides identification and fumonisin production
Sample PCR Assay for Specificity ELISA Assay for Fumonisin
Fumonisin- Concentration Presence
No. Isolate Origin F. verticillioides Producing of of
F. verticillioides Fumonisin (ppm) Fumonisin*
1 71 Gensan + + 5.997 +
2 26 Laguna + + 7.027 +
3 106 Gensan + + 0.047 -
4 25A Laguna + + 0.453 +
5 184-1 Isabela + + 0.968 +
6 214B-1 Ilocos Sur + + 4.725 +
7 126 Gensan - + 1.307 +
8 105B Gensan - + 2.157 +
9 216C-2 Ilocos Sur - + 10.484 +
10 219D-1 Ilocos Sur - + 6.754 +
11 92C Gensan - + 7.917 +
12 216B-3 Ilocos Sur + - 4.54 +
13 127A-2 Gensan + - 0.127 -
14 50B Laguna + - 0.113 -
15 5A Batangas + - 0.087 -
16 214A-2 Ilocos Sur + - 3.866 +
17 24 Laguna + - 6.491 +
18 12 Batangas + - 0.009 -
19 215D-4 Ilocos Sur + - 4.725 +
20 213C-3 Ilocos Sur + - 0.127 -
21 130B Gensan + - 6.239 +
22 142 Gensan + - 0.076 -
23 128B Gensan + - 0.013 -
24 1 Batangas + - 0.127 -
25 117 Gensan + - 4.191 +
26 86 Gensan + - 0.047 -
27 18 Lucena + - 0.141 -
White corn
28 Tanauan City Not tested Not tested 62.59 +
commercial variety
White corn
29 Tanauan City Not tested Not tested 46.77 +
commercial variety
White corn
30 commercial variety Tanauan City Not tested Not tested 3.26 +
(asymptomatic)
31 Yellow hybrid** Isabela Not tested Not tested 7.74 +
32 IPB Var 8 Lipa City Not tested Not tested 0.27 +
33 IPB Var 8 Lipa City Not tested Not tested 78.36 +
White corn Calauan,
34 Not tested Not tested 21.19 +
commercial variety Laguna
35 B-Sample 1** Station 0.081 Not tested Not tested 3.18 +
*Limit of detection for ELISA is 0.20 ppm

Mycotoxin Quantification by ELISA taken from harvested commercial corn (samples

The results from the fumonisin production analysis 28-35, Table 3). The amount of fumonisin produced is
obtained from the ELISA test confirmed that 22 out of significantly high in harvest samples from Tanauan
27 genotypes tested were F. verticillioides although and Lipa City. Such high concentration could be due to
not all of these were shown to be fumonisin-producing pre-harvest incidence of ear rot or could be brought
(Table 3). Sixteen of the identified F. verticillioides about by improper storage conditions.
were shown by PCR to be non-producers of fumonisin,
but six showed small amounts of fumonisin production DISCUSSION
using the ELISA test. The primers used for
determining fumonisin production were based on the Incidence and severity of Fusarium ear rot varies
intergenic spacer region in the rDNA (Patiño et al. widely depending on the location, growing season and
2004), and possible gene polymorphisms could be genotype. Predisposing factors are high temperature,
responsible for discrepancies in results of the ELISA drought stress, and low soil moisture. The disease is
and PCR assays. Hence, the use of other fumonisin favored by high temperatures (>28°C) and humid
gene-specific primers could be utilized to improve conditions parallel to the increase of insect population.
reliability of results. Table 3 also presents results Studies showed that the optimal temperature for

18 CB Pascual et al.
Figure 6. Dendrogram of the Fusarium isolates collected from the major corn-producing provinces of the
Philippines

production of Fumonisins by F. proliferatum is at F. verticillioides and F. proliferatum are the major

15-20°C, whereas F. verticillioides prefers the higher fumonisin-producing species of Fusarium (Nelson et
temperatures of 30°C (Marin et al. 1999). The warm al. 1992; Kpodo et al. 2000). Unlike these two species,
climate of the Philippines favors ear rot infection F. graminearum is a non-fumonisin producing
caused by F. verticillioides and promotes an increase pathogen of corn (Rheeder et al. 2002). Their report
in fumonisin levels. does not conform with the results of the present study
where two isolates identified as F. graminearum tested
Studies have affirmed that F. verticillioides is the positive for fumonisin production. F. graminearum
primary cause of ear rot and the most prevalent causes Giberrella ear rot of corn and is known to
species affecting corn worldwide (Rahjoo et al. 2008). produce the mycotoxins deoxynivalenol (DON) and
It is a highly pathogenic species causing rapid zearalenone (Parsons 2008). Ears infected by
dispersal and disease development in susceptible F. graminearum may be predisposed to
crops. This is in agreement with the results of this F. verticillioides infection and fumonisin accumulation.
study revealing F. verticillioides as the predominant
species isolated from the major corn growing areas of CONCLUSION
the country. Moreover, other species namely
F. proliferatum and F. graminearum were also isolated The rapid, sensitive and specific identification of
with minimal prevalence. F. graminearum was isolated Fusarium species. is critical to predict the mycotoxi-
from Ilocos Sur and Bukidnon where climatic genic risk of the pathogen causing ear rot of corn.
conditions are relatively humid and cooler throughout Early identification of the causal Fusarium species.
the year. On the other hand, F. proliferatum was could offer prevention against toxigenic contamination
isolated from Bohol where weather is usually dry but hereby decreasing the risk of human and animal
with few rain showers. intoxication. It also provides the information needed for
specific diagnosis and control. Molecular techniques
There are also few F. verticillioides strains that do not are proven to be reliable and rapid in identifying
produce fumonisins and these originated from fumonisin-producing species. Knowledge of the
Batangas, Laguna, Quezon, South Cotabato and Fusarium species native to the country is of
General Santos. Several species can be isolated from importance in breeding for resistance. Due to the
a single field or from a single plant. Three species predominance of F. verticillioides species, it is recom-
which are reported to be closely related to each other mended to use this species for screening in corn
belong to the Giberella fujikuroi (Fusarium) species growing areas around the country and identification of
complex. Species composition and relative frequency sources of resistance.
of the pathogens within the Fusarium complex
fluctuate in response in the seasonal variation and The incidence and severity of Fusarium ear rot and
seasonal shift of the cultural practices and cropping fumonisin production vary with growing season,
systems (Fakh et al. 2011). location, and variety grown. Pre-harvest corn with

Fumonisin-producing Fusarium species 19

Fusarium could carry on the infection, and increase Kpodo K, Thrane U, Hald B. 2000. Fusaria and
severity and degree of mycotoxin production fumonisins in maize from Ghana and their co-
especially without the proper postharvest occurrence with aflatoxins. Int J Food Micro-
management. Measurement of actual fumonisin biol 61:147-157.
production or concentration in corn grains is
necessary, particularly for white corn that is consumed Leslie JF, Summerell, BF. 2006. The Fusarium Labor-
as staple in many regions of the Philippines. With our atory Manual. Iowa, USA: Blackwell Publish-
results showing that even symptomless kernels could ing. 387p.
contain fumonisin, detection of infection or fumonisin is
very important. ELISA kits offer a means to measure Logrieco A, Bottalico A, Ricci V. 1990. Occurrence of
fumonisin, although relatively more expensive Fusarium species and their mycotoxins in
compared to molecular methods. In the case of cereal grains from some Mediterranean coun-
molecular methods, rapid techniques for extracting tries. Phytopath Medit 29:81-89.
DNA or RNA and fast amplification of DNA products
using DNA markers need to be develop. The approach Marasas WFO. 1996. Fumonisins: History, worldwide
has to be two-fold, wherein both the presence of the occurrence and impact. In: Fumonisins in
specific Fusarium species and fumonisin production Food. Jackson LS, Devries JW, Bullerman
are measured. More studies are needed on the LB, editors. 1st ed. Plenum Press, New York.
prevention and management of fumonisin contamina- p 1-17.
tion in corn grains to prevent fumonisin-related human
diseases in corn-eating communities in the country. Marasas WFO, Nelson PE, Toussoun TA. 1984. Toxi-
genic Fusarium species: Identity and Myco-
ACKNOWLEDGEMENT toxicology. University Park: Pennsylvania
State University Press. 320p.
The DA Biotechnology Program for funding support;
Ms. Catherine Almazan, Mr. Mark Angelo, Mr. Eric Marasas WFO, Jaskiewics K, Venter FS, Van Schalk-
Dinglasan and Ms. Rizalina Tiongco for technical wyk DJ. 1988. Fusarium moniliforme contami-
assistance. nation of maize in esophageal cancer areas
in Transkei. S Afr Med J 74:110-114.

Marin S, Magan N, Belli A, Ramos AJ, Canela R,

LITERATURE CITED Sanchis V. 1999. Two-dimensional profiles of
fumonisin B1 production by Fusarium monili-
Bensch MJ. 1995. Stenocarphella maydis (Berk.) Sut- forme and Fusarium proliferatum in relation to
ton colonization of maize ears. J Phytopath environmental factors and potential for mod-
143:597-599. elling toxin formation in maize grain. Int J
Food Microbiol 51:159-167.
Bullerman LB, Tsai, WJ. 1994. Incidence and levels of
Fusarium moniliforme, Fusarium proliferatum Mule G, Susca A, Stea G, Moretti A. 2004. Specific
and fumonisins in corn and corn based foods detection of the toxigenic species Fusarium
and feeds. J Food Prot 57:541-546. proliferatum and F. oxysporum from aspara-
gus plants using primers based on calmodulin
Colvin BM, Harrison, LR. 1992. Fumonisin-induced gene sequences. FEMS Microbiol Lett 230:
pulmonary edema and hydrothorax in swine. 235-240.
Mycopath 117:79-82.
Munkvold GP, McGee DC, Carlton WM. 1997. Im-
Fakhfakh MM, Yahyaoui A, Rezgui S, Elias EM, Daa- portance of different pathways for maize ker-
loul A. 2011. Identification and pathogenicity nel infection by Fusarium moniliforme. Phyto-
assessment of Fusarium spp. sampled form path 87:209-217.
durum wheat fields in Tunisia. Afr J Biotech
10(34): 6529-6539. Nelson PE, Desjardins AE, Plattner RD. 1993.
Fumonisin, mycotoxins produced by Fusari-
Gelderblom WCA, Abel S, Smuts CM, Marnewick J, um species: Biology, chemistry and signifi-
Marasas WFO, Lemmer ER, Ramljak D. cance. Ann Rev Phytopathol 31:233-252.
2001. Fumonisin-induced hepatocarcinogen-
esis: Mechanisms related to cancer initiation Nelson PE, Plattner RD, Shackelford DD, Desjardins,
and promotion. Environ Health Pres 109:291- AE. 1992. Fumonisin B1 production by Fusari-
299. um species other than F. moniliforme in Sec-
tion Liseola and by some related species.
Gherbawy YAMH, Adler A, Prillinger H. 2002. Geno- Appl Environ Microbiol 58:984-989.
typic identification of Fusarium subglutinans,
F. proliferatum and F. verticillioides strains Nicholson P, Simpson, DR, Weston G, Rezanor H,
isolated from maize in Austria. Mycobio 30(3): Lees A, Parry AK, Joyece, DW. 1998. Detec-
139-145. tion and quantification of Fusarium culmorum

20 CB Pascual et al.
 and F. graminearum in cereals using PCR Rahjoo V, Zad J, Javan-Nikkhah M, Mirzadi Gohari A,
assays. Physio Mol Plant Pathol 53:17-37. Okhovvat SM, Bihamta MR, Razzaghian J,
Klemsdal SS. 2008. Morphological and mo-
O’Donnell K, Gherbawy Y, Schweigkofler W, Adler A, lecular identification of Fusarium isolated
Prillinger, H. 1999. Comparative phylogenetic from maize ears in Iran. J Plant Pathol 90(3):
analysis of Fusarium oxysporum and related 463-468.
species from maize using DNA sequence and
RAPD data. J Phytopath 147: 445-452. Tsai Y, Olson BH. 1991. Rapid method of direct ex-
traction of DNA from soil and sediments. App
Pascale M, Visconti A, Chelkowski J. 2002. Ear rot Envi Microbiol 57(4):1070-1074.
susceptibility and mycotoxin contamination of
maize hybrids inoculated with Fusarium spe- Zhen YZ. 1984. The culture and isolation of fungi from
cies under field conditions. Eur J Plant Pathol the cereals in five high and three low inci-
108:645-651. dence counties of esophageal cancer in He-
nan Province. J Chin Tumor 6:27-29.
Patino B, Mirete S, Gonzalez-Jaen T, Mule G, Rodri-
guez TM, Vazquez C. 2004. PCR detection
assay of fumonisin-producing Fusarium verti-
cillioides strains. J Food Prot 6: 1278-1283.

Fumonisin-producing Fusarium species 21

View publication stats