Pakistan Veterinary Journal

ISSN: 0253-8318 (PRINT), 2074-7764 (ONLINE)

DOI: 10.29261/pakvetj/2024.217
REVIEW ARTICLE
Newcastle Disease Virus as a Viral Vector Platform for Poultry Vaccines: A Review
Faisal Masoud1*, Muhammad Adnan Ashraf 2, Muhammad Wasim Usmani3, Azhar Rafique4 and Rizwan Aslam1
1
Institute of Microbiology, University of Agriculture, Faisalabad, Pakistan; 2Institute of Microbiology, University of
Veterinary and Animal Sciences, Lahore, Pakistan; 3Department of Veterinary Pathology, Ziauddin University, Karachi,
Pakistan; 4Department of Zoology, Government college university, Faisalabad, Pakistan.
*Corresponding author: [email protected]

ARTICLE HISTORY (24-033) ABSTRACT

Received: January 19, 2024 Viral vector vaccines are excellent in stimulating a strong immune response to the
Revised: June 30, 2024
Accepted: July 13, 2024
vaccine antigen. The discovery of reverse genetics has given us an empirical
Published online: August 07, 2024 foundation for the use of the Newcastle disease virus (paramyxovirus), as a vaccine
Key words: vector. It has the potential to be a promising virus vector due to its ability to
Newcastle disease replicate in the respiratory system, modular nature of transcription, capacity to
Reverse genetics induce local and systematic immune responses, lower probability of recombination
Recombinant vaccine in host cells, high degree of stability to the foreign gene, high titer growth in cell
NDV-vectored vaccines lines, the natural pathogen of poultry, and a proven track record of safety, efficacy,
viral vector vaccine and immunogenicity. Here, we elaborate on the biology of the Newcastle disease
Health virus, important steps in plasmid construct for in vitro transcription, rescue of
recombinant NDVs, pre-clinical assessment of NDV vectored poultry vaccines,
main bottlenecks, and future prospects. By eliminating the primary barrier such as
interference of maternally derived antibodies (MDAs), NDV vectored marketable
vaccines can reduce vaccinal stress on birds while also relieving economic burden
on poultry producers. Furthermore, innovative NDVs can be employed as marker or
DIVA vaccines in disease eradication campaigns.

To Cite This Article: Masoud F, Ashraf MA, Usmani MW, Rafique A, and Aslam R, 2024. Newcastle disease virus
as a viral vector platform for poultry vaccines: a review. Pak Vet J, 44(3): 539-546.
http://dx.doi.org/10.29261/pakvetj/2024.217

INTRODUCTION spread include mass vaccination, surveillance, physical

separation, and pre-emptive culling of infected birds
The poultry industry is vital in human life, (Roth and Sandbulte, 2021). Mass vaccination reduces
providing primary animal protein through eggs and economic losses, prevents inter-species virus spread, and
meat. In 2022, humans consumed an estimated 143 is a primary prophylactic measure recommended by
million tons of poultry meat (Hussain et al., 2024). As authorities.
the global demand for food is increasing (Van Dijk et Traditionally, vaccines are developed using a
al., 2021), the poultry sector is expanding rapidly to modified live virus or a chemically inactivated virus.
cope with the demand. High-density poultry farming has However, these conventional vaccines have issues with
replaced conventional farming to suit market demand. safety, efficacy, cost, and potential reversion to wild
However, this alternative strategy has spread several pathogens (Abdelaziz et al., 2024). Live vaccines also
diseases. Different infectious agents including; bacteria, struggle with DIVA (differentiation of infected from
viruses, and fungi, have been isolated from poultry birds, vaccinated animals), which is crucial for disease tracking
causing ailments that lead to economic losses (Yehia et (Ravikumar et al., 2022). To address these drawbacks,
al., 2023). Viral infections are common in the poultry scientists are developing better vaccines that offer broad-
industry and their Control is essential in reducing the spectrum protection and avoid the limitations of earlier
zoonotic risk and limiting new variants in wild birds and generations vaccines (Jorge and Dellagostin, 2017). This
their reservoirs. is true for developing vaccines against poultry diseases,
The virus outbreaks in farmed poultry negatively where the primary concerns are the financial constraints
impact feed intake, feed conversion ratio (FCR), body and the vaccination of a substantial population.
weight gain, and egg and meat production (Cui et al., Recent advances in reverse genetics technology
2018). The in-practice preventive measures for disease (Chen et al., 2022), now allow for customized virus

539
 540 Pak Vet J, 2024, 44(3): 539-546.

generation in vitro. By introducing multiple genes into considered an essential tool for developing future vaccines
viral genome; efficient, safe, and cost-effective viruses (Yan and Samal, 2008).
can be produced. This approach has enabled researchers to The NDV obeys the rule of six, which means its
produce viral vector vaccines (Romanutti et al., 2020). nucleotides must be multiples of six for efficient
Viral vector includes a variety of poultry viruses, such as replication, because the N protein can accommodate six
Fowl adenoviruses (FAdVs), Marek’s disease virus nucleotides simultaneously (Kim and Samal, 2019). The
(MDV), herpes virus of turkey (HVT), Fowlpox virus virus has a bipartite promoter with two discontinuous
(FWPV), and Newcastle disease virus (NDV). regions: conserved region I (first 18 nucleotides) and
This review covers the biology of NDV, earlier conserved region II (nucleotides 73-90) (Marcos et al.,
history of its in vitro rescue, pre-requisites for the 2005).
production of recombinant NDV (rNDV) in-vitro, the role The virus binds by attaching its surface glycoproteins
of maternally derived antibodies in the vaccine failure, (HN) to sialic acid-linked glycoproteins or gangliosides
and prior research on the development and evaluation of located in host cells. After the genome entry into the host
NDV vectored vaccines. cell cytoplasm, the NDV negative sense genome
transcribes (by viral RNA polymerase; N, P and L
Biology of Newcastle disease virus: The Newcastle proteins) into positive-sense genome, followed by the
disease virus (NDV) is a member of the genus Avulavirus transcription of the positive sense genome into viral
in the family Paramyxoviridae. The members of this protein by host cell ribosomes. The same positive sense
genus are also termed avian paramyxoviruses (AMPV), RNA genome is used as a template by host RNA
which are subdivided into fifteen serotypes (APMV-I to polymerase to produce the negative sense genomic RNA
APMV-XV) based on serological tests such as for NDV progeny virus (Kim and Samal, 2016). The
hemagglutination inhibition (HI) and Neuraminidase transcription starts from 3` leader sequence, and the
inhibition (NI) tests. Newcastle disease virus belongs to mRNA from each gene is transcribed from gene start to
avian paramyxovirus serotype-I (Dharmayanti et al., gene end sequence (Bello et al., 2020). The transcription
2024). As determined by the APMV-I fusion protein re-initiation of downstream genes is inconsistent (polar
sequence, the NDV isolates are classified into two gradient transcription), presenting the gradient
divergent classes, I & II. Class I has only one genotype transcription in the downstream genes (Figure 1-C). The
and does not produce disease in birds. Meanwhile, Class newly formed genomic RNA is wrapped in the N, P, and
II has 21 genotypes, all being pathogenic except L proteins to produce nucleocapsid, which is then
genotypes I, II, and X (Goraichuk et al., 2023). assembled with the matrix and surface glycoproteins. The
The NDV is a negative sense, non-segmented, M protein facilitates the release from the host cell (Cong
enveloped RNA virus with a pleomorphic shape having a et al., 2023).
virion size of 200-300 nm (Figure 1-A). The virus's The NDV escapes the host immune system by using
genome comprises six genes, NP, P, M, F, HN, and L its V protein, which inhibits the INF signaling pathway
genes, that encode for eight different proteins. The and functioning of MDA5 and RIG1 (PPRs). This inhibits
structural proteins include the fusion protein (F), the host's inflammatory and antiviral responses, facilitating
hemagglutinin-neuraminidase protein (HN), matrix NDV replication (Behboudi and sofiani, 2021).
protein (M), nucleoprotein (NP), phosphoprotein (P), and
large polymerase protein (L). The other two proteins, Early history of NDV rescue: The term “reverse
which are non-structural, ‘V’ and ‘W’ proteins, are genetics” was introduced by Charles weissmann in 1974,
encoded by the ‘p gene’ via the RNA editing mechanism describing the generation of viruses from cloned cDNA.
(Ganar et al., 2014). The F and HN proteins are surface This technique has enabled researchers to explore the
glycoproteins, while the non-glycosylated M protein is genome of viruses, and NDV is one of the earliest viruses
beneath the envelope, facilitating the virus's assembly and studied as a viral vector (Chen et al., 2022). It all began
budding. The NP, P, and L proteins make the (Figure 2) with the rescue of Lasota strain of NDV from
ribonucleoprotein complex, which acts as a template for plasmids by in-vitro transcription (Peeters et al.,1999),
the transcription and replication of the viral genome followed by clone-30 strain (Roomer-Oberdo et al.,
(Figure 1-B). The NP protein encapsidates the viral 1999). The recombinant Beaudette C (rBC) strain was
genome, L protein acts as a viral polymerase and P protein first to express the foreign gene (Krishnamurthy et al.,
is its co-factor. The encapsidation of NP into the viral 2000), then the heterologous viral gene was expressed by
genome is of prime importance at the start of transcription NDV (Nakaya et al., 2001; Swayne et al., 2003). Later on,
(Kim and Samal, 2016). the concerns about the recombination of NDV, with host
The genome lengths of NDV isolates from all over or other viruses were scientifically disproved (Song et al.,
the world are 15,186 nt or 15,192 nt, or 15,198 nt 2011).
(Dimitrov et al., 2019). The typical NDV genome has 55
nucleotides (nt) leader sequence at 3´ end and 114 (nt) Plasmid construction for NDV-vectored vaccines: The
trailer sequence at 5´ end. Each gene is marked by the infectious NDV can be generated by simultaneous
start and stop signals. The gene boundaries of NDV are transfection of the full-length (genomic RNA) and helper
separated by the intergenic sequence(s) (IGs), one (nt) plasmids (NP, P, and L genes) into the cell lines using
among the NP, P, and M genes. The IGs of F and HN are appropriate polymerase system (Figure 3) (Kim and
31 nt, while that of the HN and L genes is 47 nts. The Samal, 2016). In NDV, the foreign nucleotide complex is
increase or decrease of these intergenic sequences affects inserted as an independent transcription unit (ITU). The
the attenuation of the NDV isolate, which may be gene start (ACGGGTAGAA) and stop signals
 541 Pak Vet J, 2024, 44(3): 539-546.

(TTAGAAAAAA) are taken from the NDV, and a Kozak globally (Figure 4). The NDV vaccines are primarily
sequence (GCCACC) is added in upstream of the foreign derived from Genotype-I (asymptomatic strains), such as
gene ORF to enable the efficient transcription by V4, I2, and Ulster-2C, or from Genotype II, which
eukaryotic polymerase (Bello et al., 2020). For RNA includes Hitchner, B1, Clone-30, LaSota, and VG/GA
polymerase II system, the CMV promoter and the SV40 strains (Hu et al., 2022). The protective titer of antibodies
poly-A tail as terminator signals are used. While in the against ND infection ranges from 3 log 2 to 6 log 2. In
case of the T7 RNA polymerase system, the T7 promoter poultry birds, the antibodies are the primary mechanism of
and terminators can serve the purpose (Molouki and protection against infections while the cell-mediated
Peeters, 2017). To efficiently attach the heterologous immune (CMI) response plays a key role in reducing the
surface protein to the matrix protein of NDV, the shedding of virus. The poultry vaccines are usually judged
transmembrane (TM) and cytoplasmic tail (CT) of the by the degree of protection against clinical disease, lesion
heterologous gene are replaced with the CT of the fusion development, decrease in virus shedding, and neutralizing
protein of NDV (Kim and Samal, 2018). After the stop antibodies titer (Rautenschlein and Schat, 2024). The
codon, NDV stop signal, and one nucleotide as the ultimate objective of a vaccination is to reduce the
intergenic space are added. Therefore, the foreign shedding of a particular virus and increase the infectious
nucleotide complex should be arranged as follows: NDV dose of that virus for future infections. Here, we describe
start signal --- Kozak sequence --- ORF of foreign gene the significance of poultry viral diseases (Hein et al.,
(without stop codon, cytoplasmic tail, and 2021) and their NDV-vectored vaccines (Table 1).
transmembrane) --- CT sequence of NDV fusion protein --
- stop codon --- NDV stop signal --- nucleotide base for Avian influenza (AI): It is caused by Avian influenza
intergenic space. virus (AIV), which has importance due to its zoonotic
The NDV abides the rule of six, meaning its genome potential (Subedi et al., 2024). Pathotypically; divided
length must be a multiple of six for efficient encapsidation into low pathogenic avian influenza (LPAI), i.e., H9N2,
by the N protein, which is required to start the viral and high pathogenic avian influenza (HPAI), i.e., H5N1
genome transcription (Figure 1-D) (Kim and Samal, and H7N7 (Kim and Samal, 2019). The protection against
2019). Therefore, the rule of six must be considered while these infections is mounted by the neutralizing antibodies
designing the foreign nucleotide complex. It can be produced against HA and NA (Yang et al., 2023). The
adjusted by increasing or decreasing the intergenic space HPAI produces infections in humans. So, their control is
before or after the foreign nucleotide complex (Peeters et an ultimate requirement (Peacock et al., 2019). While,
al., 1999). LPAI particularly H9N2, are considered potential donors
The exact 5’ and 3’ ends of genome are also required for the virulent genes (Bhat et al., 2022). Thus, its control
to replicate recombinant viruses generated by in-vitro is also required for human health security (Charostad et
transcription. To achieve this, the ribozymes (self- al., 2023). Along with conventional vaccines, different
cleaving RNAs) (Avis et al., 2012) are placed in the virus strains of NDV have been used to express the
transcription vector to produce the exact ends. In common various pathotypes of AIV.
practice, the hammerhead ribozyme (HamRz), The LaSota strain has been used to express the
(GCGACTAGTTGTTAAGCGTCTGATGAGTCCGTGA hemagglutinin protein of different strains like H5N1
GGACGAAACTATAGGAAAGGAATTCCTATAGTC) (Lardinois et al., 2012) and H5N2 (Veits et al., 2006). The
(67 bp) is placed after the CMV promoter and before the protective efficacy of these vaccines has been tested in the
genome starts to produce the exact 5’ end. Meanwhile, SPF birds, showing 100% protection via intramuscular
hepatitis delta virus ribozyme (HdvRz) (GGGTCGGCAT and 80% via oculonasal route (Ma et al., 2017). In 2017,
GGCATCTCCACCTCCTCGCGGTCCGACCTGGGCA china encountered an H7N9 outbreak in poultry; as a
TCCGAAGGAGGACGTCGTCCACTCGGATGGCTAA counter strategy, the LX strain vectored H7N9 vaccine
GGGAGAGCTCG) (84 to 89 bp) is added after the trailer was deployed, which provided 80% protection (Hu et al.,
sequence of NDV genome before the terminator to 2017).
produce the accurate 3’ end (Li et al., 2011). In many countries, H9N2 vaccination (inactivated
NDV adopts the gradient transcription mechanism vaccines) has been adopted nationally or locally as a
from 3’ NP-P-M-F-HN-L 5’. The non-coding region preventive measure (Dong et al., 2022). Various strains
between P and M genes was identified as the best site for like LaSota, NDV/AI4-TFHN, and rmNA-H9 were used
heterologous gene expression (Zhao et al., 2015). It can to express the H9N2 hemagglutinin protein. All constructs
accommodate the 4.5 kb length gene, and one NDV vector expressed the foreign gene, but chimeric NDV showed
can express three foreign genes (Kim and Samal, 2019). better efficiency than wild NDV (Nagy et al., 2016; Liu et
The RNA polymerase can be RNA polymerase II al., 2018; Xu et al., 2019; Masoud et al., 2023). All these
(Masoud et al., 2022) or T7 RNA polymerase. The T7 studies demonstrate the ability of NDV to act as a vaccine
RNA polymerase can be provided by modified viruses, vector for avian influenza.
plasmids, or cell lines stably expressing the polymerase.
Meanwhile, the RNA polymerase II system does not Infectious bursal disease (IBD): IBD also known as,
require such arrangement because the cells naturally Gumboro disease is caused by Infectious bursal disease
produce this enzyme (Molouki and Peeters, 2017). virus (IBDV), which replicates in the bursa of fabricius of
birds and damages antibody-producing B cells (Hammad
NDV-vectored vaccines for the major poultry et al., 2022). As a result, immunosuppression occurs, and
pathogens: The Newcastle disease virus is a natural birds are susceptible to opportunistic pathogens (Du et al.,
poultry pathogen, and live attenuated vaccines are used 2023; Barka et al., 2023).
 542 Pak Vet J, 2024, 44(3): 539-546.

Table 1: List of NDV vectored vaccines tested against various poultry birds’ infections
Vaccine type Pathogen Disease Antigen expressed Animal model Route/Method Dose Reference
Live Clone-30 HPAIV AI HA-gene SPF-Chicken Oculonasal 1x106 EID50 Veits et al., 2006
H5N1
Live LaSota HPAIV AI HA-gene SPF-Chicken Oculonasal vs drinking 1x106 EID50 Lardinois et al., 2012
H5N1 water
Live LaSota IBV IB S2-gene SPF-Chicken Ocular 1x106 EID50 Toro et al., 2014
Live LaSota ILTV ILT gD-gene SPF-Chicken & Intranasal/ Intraocular 1x107 TCID50 Zhao et al., 2014
commercial broiler
Live LaSota ILTV ILT gD-gene SPF-Chicken Oculonasal 1x106 TCID50 Basavarajappa et al., 2014
Live LaSota LPAIV AI HA-gene SPF-Chicken Oculonasal/Intramuscular 1x107 FFU Nagy et al., 2016
H9N2
Live LaSota HPAIV AI HA-gene SPF-Chicken Coarse sprayer/aerosol 1x106 EID50 Ma et al., 2017
H5N2
6
Live LX strain HPAIV AI HA-gene SPF-Chicken Intranasal 5x10 EID50 Hu et al., 2017
H7N9
Live F-Strain IBDV IBD VP2-gene SPF-Chicken Intranasal 1x105 EID50 Dey et al., 2017
Live NDV/AI4- LPAIV AI HA-gene Chicken Immunized Oculonasal 1x106 EID50 Liu et al., 2018
TFHN H9N2 with LaSota vaccine
Live LaSota IBV IB S-gene SPF-Chicken Ocular 1x107 EID50 Shirvani et al., 2018
Live LaSota IBV IB Codon optimized SPF-Chicken Oculonasal 1x106 PFU/100 Abozeid et al., 2019
S-Protein μL
Live rmNA LPAIV AI HA-gene SPF-Chicken Oculonasal 1x106 EID50 Xu et al., 2019
H9N2
Live LaSota FAdV-4 HPS Fiber-2 SPF-Chicken Intramuscular 1x107 EID50 Tian et al., 2020
Live LaSota IBDV IBD VP2-gene SPF-Chicken Oculonasal 1x107 EID50 Qiao et al., 2021
7
Live LaSota LPAIV AI HA-gene SPF-Chicken Oculonasal 3x10 EID50 Masoud et al., 2023
H9N2
IBD; Infectious bursal disease, IBDV; Infectious bursal disease virus AI: Avian influenza, HPAIV: high pathogenic avian influenza virus, LPAIV: Low
pathogenic avian influenza virus IB: Infectious bronchitis, IBV: infectious bronchitis virus, ILT: Infectious laryngeotracheitis, ILTV: Infectious
laryngeotracheitis virus HPS: Hydro pericardium syndrome, FAdV-4: Fowl adeno virus type 4, SPF-Chicken: Specific pathogenic free chickens.

Fig. 1: Schematic diagram of (A) NDV

genome (B) Newcastle disease virus (C)
Gradient transcription (D) Rule of six
(Figure designed by using MS office).

Fig. 2: key milestones in the

development of NDV as a
vaccine vector (Figure designed
by using MS office).

To produce viral vector vaccines, the VP2 gene of IBD chickens with aforementioned vaccine candidates provided
was inserted at different positions in NDV strains (LaSota, 80% protection against challenge infection, demonstrating
modified LaSota, and F strain). The immunization of their effectiveness (Dey et al., 2017; Qiao et al., 2021).
 543 Pak Vet J, 2024, 44(3): 539-546.

Fig. 3: Important technical points for

consideration, when using NDV as a viral
vector: A) The full-length NDV genome is
sandwiched between the hammer head (Ham
Rz) and hepatitis delta virus ribozyme. The
foreign gene is in the intergenic space of P and
M genes. Each gene of NDV has gene start
(GS) (Brown) and gene end (GE) (Green)
signals, so the foreign nucleotide complex
should contain both of these sequences. The
foreign gene should be multiple of six. B) the
support plasmids of N, P and L genes are
provided, these will make the viral polymerase,
which will convert the negative sense RNA to
positive sense RNA. In each support plasmid,
the ORF of gene is preceded by the kozak
sequence under the CMV promoter and SV-40
poly A Tail C) the full length and support
plasmids are transfected to cell lines, the RNA
polymerase will read all the four construct, as
a result three proteins (Phosphoprotein,
Nucleoprotein and large polymerase) and
negative sense RNA copy of NDV genome are
produced. These proteins act as viral
polymerase and convert the negative sense
RNA to positive sense RNA, which ultimately
translated into viral proteins and negative copy
of genome. The infectious NDV burst out the
cells and then propagated in the embryonated
chicken eggs. (Figure designed by using MS
office)

Fig. 4: In this illustration, the NDV is carrying three protective antigens, the two are intrinsic proteins “F” and “HN”, while third is depicted here to
demonstrate the heterologous antigen of different viruses. Ultimately the NDV transformed to recombinant Newcastle disease virus (rNDV).
Intramuscular route: Vaccine antigen is either carried by nucleated cells and represented by MHC-I pathway, or processed and presented by MHC-II,
pathway via Antigen presenting cells APCs. PAMPs; pathogen associated molecular pattern, PRRs; Pathogen recognition receptors. Oculo-Nasal
route: Nasal associated lymphoid tissue (NALT), Conjunctiva associated lymphoid tissue (CALT), Head associated lymphoid tissue (HALT). Oral
route: Payer’s patches, M cells. (The figure was designed by using MS office).
 544 Pak Vet J, 2024, 44(3): 539-546.

Infectious bronchitis (IB): The IB is caused by the Conclusion and future perspectives: There is a dire
infectious bronchitis virus (IBV), which targets the need in developing effective vaccines against the poultry
reproductive and urogenital tracts of birds (Abozeid, pathogens. The Virus vectors, including NDV have
2023). For this disease, the different chimera of NDV revolutionized vaccinology, (Centlivre and Combadière,
have been used as a vector to harbor the spike protein (S) 2015). The NDV can act as a suitable vaccine vector
of IBV. Later on, the protection level was assessed in the because of its ability to express foreign genes as the
SPF birds and significant protection against challenging natural antigen, initiating the humoral, cellular and
infections was observed (Toro et al., 2014; Shirvani et al., mucosal immune responses (De Swart and Belov, 2023).
2018; Abozeid et al., 2019). The NDV can be the ideal vaccine vector, due to its short
modifiable genome, high titer growth in embryonated
Infectious laryngotracheitis (ILT): Infectious chicken eggs, cell lines, and respiratory tract of birds,
laryngotracheitis; an important respiratory problem having stable expression of foreign gene (4.5 kb), cytoplasmic
an impact in egg production of birds (Gowthaman et al., replication in the host cells and ease of administration via
2020). To produce NDV-vectored ILT vaccines, the drinking and spray method (Yang et al., 2024).
surface glycoproteins of ILT (gB, gD, and gC) were The conventional recombination techniques, such as
introduced in the NDV genome. The pre-clinical trials in restriction enzyme digestion and ligation, and bacterial
chickens showed that NDV-expressing gD protein artificial chromosomes (BAC), are used for developing
provided complete protection (Basavarajappa et al., 2014; recombinant vaccines, but these are time-consuming and
Zhao et al., 2014). labor-intensive. Efforts should be directed towards the
CRISPR/Cas9 technology; preferably HDR (homology-
Hydro-pericardium syndrome (HPS): The hydro- directed reparation pathway), for genome manipulation
pericardium syndrome (adenovirus infection) is associated and viral vector vaccine development (Vilela et al., 2020;
with growth retardation and significant mortality in Bhujbal et al., 2022). The Cre/lox system facilitates the
poultry birds (El-Shall et al., 2022). In field conditions, insertion of multiple antigens in the virus vector
the autogenous vaccine prepared from the liver backbone, aiding the development of NDV-based
homogenate of infected chicken is employed, whereas multivalent vaccines (Chang et al., 2018).
inactivated vaccines are administered to breeders. Adjuvants are essential parts of vaccines as they
Recently, the NDV-vectored vaccine with FAdv-4 fiber-2 enhance immune response. Alum or emulsion adjuvants
gene was developed. It provides complete protection were previously used, but to enhance humoral and cellular
when administered intramuscularly (Tian et al., 2020). immune responses, novel adjuvants are required. Viral
vectors possess inherent adjuvant properties, like NDV
Role of maternally derived antibodies (MDAs) and has the capacity to trigger the alpha and beta interferons
way forward: The bottleneck for the NDV as a vaccine production, ultimately upregulating the immune response
vector is the interference produced by the maternally (Ewer et al., 2016). Efforts should be focused on using the
derived antibodies (MDAs) (Liu et al., 2023), which molecular adjuvants, either by fusing them with gene of
protects chicks from infection (Hu et al., 2020), but also interest or co-expressing in NDV genome (Mahony,
hampers NDV vectored vaccines replication. 2021).
Many efforts have been made to reduce the effects of The research can be directed to understand the impact
the MDAs on NDV vaccination, one novel approach is the of MDAs on B cell activation, cytokines role in B cell
use of chimeric NDV. It is based on the fact that the NDV stimulation, the T cell's immune responses against NDV-
belongs to APMV-1, and has low cross reactivity with vector and its significance in the development of B cells,
other serotypes. In one study, the fusion and and how MDAs or other antibodies suppress the vaccine
hemagglutinin-neuraminidase proteins of NDV were immunization (Hu et al., 2020).
replaced with the counterpart of AMPV-8 (Steglich et al., The previous work of the past twenty years has
2013). In another approach, the ectodomain of fusion and proven the NDV as a potential vaccine vector. The
hemagglutinin-neuraminidase proteins of NDV was vaccines based on this platform can provide a practical
replaced with the same parts of APMV-2 (Kim et al., strategy for rapid, efficient, and economical immunization
2017; Liu et al., 2018). Both recombinant bivalent of poultry birds. However, further research is required in
vaccines provided optimal protection, suggesting viable the utilization of modern techniques for the manipulation
approach to minimize the effects of MDAs. of NDV genome, usage of molecular adjuvants and
As mentioned earlier, due to MDAs, the B cell curtailment of MDAs interference for the development of
response towards the antigen is reduced, resulting in weak NDV vectored vaccines.
immune response. Thus, the NDV has been engineered to
express the granulocyte-macrophage colony-stimulating
Authors contributions: FM: Conceptualization of idea
factor (GM-CSF), showing that NDV replication in the
and original draft writing, MAA and MWU: Data
presence of MDAs is comparable with the parenteral virus
collection and Methodology, AR and RA: Formal analysis
(Zhang et al., 2016). The study suggested that expressing
and Visualization.
the cytokines along with foreign genes in the NDV can
mitigate the effects of MDAs. As the MDAs hijack a
REFERENCES
considerable amount of antigen, leaving behind a small
amount to trigger humoral immune response, using higher Abdelaziz K, Helmy YA, Yitbarek A, et al., 2024. Advances in poultry
antigen concentration ensures more antigen is available to vaccines:Leveraging biotechnology for improving vaccine
provoke the host immune system (Hu Z and Liu X, 2021). development, stability, and delivery. Vaccines 12:134.
 545 Pak Vet J, 2024, 44(3): 539-546.

Abozeid HH, 2023. Global emergence of infectious bronchitis virus Gowthaman V, Kumar S, Koul M, et al., 2020. Infectious
variants:evolution, immunity, and vaccination challenges. laryngotracheitis:etiology, epidemiology, pathobiology, and
Transbound Emerg Dis 1:1-28. advances in diagnosis and control-a comprehensive review. Vet Q
Abozeid HH, Paldurai A, Varghese BP, et al., 2019. Development of a 40:140-161.
recombinant newcastle disease virus-vectored vaccine for Hammad N, EL-Sherry S, Abd-Elghaffar S, et al., 2022. Molecular
infectious bronchitis virus variant strains circulating in egypt. Vet detection and immune-profiling of circulating very virulent
Res 50:12. infectious bursal disease in broiler farms in egypt. Pak Vet J 42:316
Avis JM, Conn GL, and Walker SC, 2012. Cis-acting ribozymes for the - 321.
production of RNA in vitro transcripts with defined 5' and 3' ends. Hein R, Koopman R, García M, et al., 2021. Review of poultry
Methods Mol Biol 941:83-98. recombinant vector vaccines. Avian Dis 65:438-452.
Barka S. Orakpoghenor O, Andamin A, et al., 2023. Efficacy of different Hu Z, and Liu X, 2021. Antigen camouflage and decoy” strategy to
live infectious bursal disease vaccines on antibodies to infectious
overcome interference from maternally derived antibody with
bursal disease virus and Newcastle disease vaccine La Sota in ISA
newcastle disease virus-vectored vaccines:more than a simple
brown chicks. J Res Vet Sci 1:66-71.
combination. Front Microbiol 12:735250.
Basavarajappa MK, Kumar S, Khattar SK, et al., 2014. A recombinant
newcastle disease virus (NDV) expressing infectious Hu Z, He X, Deng J, et al., 2022. Current situation and future direction
laryngotracheitis virus (ILTV) surface glycoprotein D protects of newcastle disease vaccines. Vet Res 53:99.
against highly virulent ILTV and NDV challenges in chickens. Hu Z, Liu X, Jiao X, et al., 2017. Newcastle disease virus (NDV)
Vaccine 32:3555-3563. recombinant expressing the hemagglutinin of H7N9 avian influenza
Behboudi E, and Sofiani VH, 2021. Immune responses to newcastle virus protects chickens against NDV and highly pathogenic avian
disease virus as a minor zoonotic viral agent. J Zoon Dis 5:12-23. influenza A (H7N9) virus challenges. Vaccine 35:6585-6590.
Bello MB, Yusoff K, Ideris A, et al., 2020. Exploring the prospects of Hu Z, Ni J, Cao Y, et al., 2020. Newcastle disease virus as a vaccine
engineered newcastle disease virus in modern vaccinology. viruses vector for 20 years:a Focus on maternally derived antibody
12:451. interference. Vaccines 8:222.
Bhat S, James J, Sadeyen JR, et al., 2022. Coinfection of chickens with Hussain M, Hussain J, Usman M, et al., 2024. Poultry consumption and
H9N2 and H7N9 avian influenza viruses leads to emergence of perceptions in tehsil shakargarh, punjab, pakistan: implications for
reassortant H9N9 virus with increased fitness for poultry and a public health during COVID-19. Heliyon 10:e29403.
zoonotic potential. J Virol 96:e01856-21. Jorge S, and Dellagostin OA, 2017. The Development of veterinary
Bhujbal S, Bhujbal R, and Giram P, 2022. An overview: CRISPR/Cas- vaccines:a review of traditional methods and modern
based gene editing for viral vaccine development. Expert Rev biotechnology approaches. Biotechnol Res Innov 1:6-13.
Vaccines 21:1581-1593. Kim SH, and Samal SK, 2018. Reverse genetics for newcastle disease
Centlivre M, and Combadière B, 2015. New challenges in modern virus as a vaccine vector. Curr Protoc Microbiol 48:18.5.1-
vaccinology. BMC Immunol 16:18. 18.5.12.
Chang P, Yao Y, Tang N, et al., 2018. The application of NHEJ- Kim SH, and Samal SK, 2016. Newcastle disease virus as a vaccine
CRISPR/Cas9 and Cre-Lox system in the generation of bivalent vector for development of human and veterinary vaccines. Viruses
duck enteritis virus vaccine against avian influenza virus. Viruses 8:183.
10:81.
Kim SH, and Samal SK, 2019. Innovation in newcastle disease virus
Charostad J, Rukerd MRZ, Mahmoudvand S, et al., 2023. A
vectored avian influenza vaccines. Viruses 11:300.
comprehensive review of highly pathogenic avian influenza (HPAI)
Kim SH, Paldurai A, and Samal SK, 2017. A novel chimeric newcastle
H5N1:an imminent threat at doorstep. Travel Med Infect Dis
55:102638. disease virus vectored vaccine against highly pathogenic avian
Chen H, Liu H, and Peng X, 2022. Reverse genetics in virology:a double influenza virus. Virology 503:31-36.
edged sword. Biosaf health 5:303-313. Krishnamurthy, S, Huang Z, and Samal SK, 2000. Recovery of a virulent
Cong J, Feng X, Kang H, et al., 2023. Structure of the newcastle disease strain of newcastle disease virus from cloned cDNA: expression of
virus L protein in complex with tetrameric phosphoprotein. Nat a foreign gene results in growth retardation and attenuation.
Commun 14:1324. Virology 278:168-182.
Cui N, Huang X, Kong Z, et al., 2018. Newcastle disease virus infection Lardinois A, Steensels M, Lambrecht B, et al., 2012. Potency of a
interferes with the formation of intestinal microflora in newly recombinant NDV-H5 vaccine against various HPAI H5N1 virus
hatched specific-pathogen-free chicks. Front Microbiol 9:900. challenges in SPF chickens. Avian Dis 56:928-936.
De Swart RL, and Belov GA, 2023. Advantages and challenges of Li BY, Li XR, Lan X, et al., 2011. Rescue of newcastle disease Virus from
newcastle disease virus as a vector for respiratory mucosal cloned cDNA using an RNA polymerase II promoter. Arch Virol
vaccines. Curr Opin Virol 62:101348. 156:979-986.
Dey S, Chellappa MM, Pathak DC, et al., 2017. Newcastle disease virus Liu J, Xue L, Hu S, et al., 2018. Chimeric newcastle disease virus-
vectored bivalent vaccine against virulent infectious bursal disease vectored vaccine protects chickens against H9N2 avian influenza
and newcastle disease of chickens. Vaccines 5:31. virus in the presence of pre-existing NDV immunity. Arch Virol
Dharmayanti NI, Nurjanah D, Nuradji H, et al., 2024. Newcastle 163:3365-3371.
disease virus:the past and current situation in indonesia. J Vet Sci Liu M, Shen X, Yu Y, et al., 2023. Effect of different levels of maternally
25:e3. derived genotype VII newcastle disease virus-specific
Dimitrov KM, Abolnik C, Afonso CL, et al., 2019. Updated unified hemagglutination inhibition antibodies on protection against
phylogenetic classification system and revised nomenclature for virulent challenge in chicks. Viruses 15:1840.
newcastle disease virus. Infect Genet Evol 74:103917. Ma J, Lee J, Liu H, et al., 2017. Newcastle disease virus-based H5
Dong J, Zhou Y, Pu J, et al., 2022. Status and challenges for vaccination
influenza vaccine protects chickens from lethal challenge with a
against avian H9N2 influenza virus in china. Life 12:1326.
highly pathogenic H5N2 avian influenza virus. npj Vaccines 2:33.
Du X, Ahmad L, Wang B, et al., 2023. Infectious bursal
Mahony TJ, 2021. The role of adjuvants in the application of viral vector
disease:distribution, pathogenesis and pathology. Pak Vet J 43:388-
395. vaccines. In:viral vectors in veterinary vaccine development;
El-Shall NA, El-Hamid HSA, Elkady MF, et al., 2022. Epidemiology, Vanniasinkam T, Tikoo SK, and Samal SK, (eds), Springer, Cham,
pathology, prevention, and control strategies of inclusion body Switzerland, pp:37-50.
hepatitis and hepatitis-hydropericardium syndrome in poultry:a Marcos F, Ferreira L, Cros J, et al., 2005. Mapping of the RNA promoter
comprehensive review. Front Vet Sci 9:963199. of newcastle disease virus. Virology 331:396 - 406.
Ewer KJ, Lambe T, Rollier CS, et al., 2016. Viral vectors as vaccine Masoud F, Mahmood MS, Abbas RZ, et al., 2023. Engineered newcastle
platforms:from immunogenicity to impact. Curr Opin Immunol disease virus expressing the haemagglutinin protein of H9N2
41:47-54. confers protection against challenge infections in chickens. Process
Ganar K, Das M, Sinha S, et al., 2014. Newcastle disease virus:current Biochem 130:281-290.
status and our understanding. Virus Res 184:71-81. Masoud F, Mahmood MS, Rahman SU, et al., 2022. An efficient approach
Goraichuk IV, Gerilovych A, Bolotin V, et al., 2023. Genetic diversity of for the recovery of lasota strain of newcastle disease virus from
newcastle disease viruses circulating in wild and synanthropic birds cloned cDNA by the simultaneous use of seamless PCR cloning
in ukraine between 2006 and 2015. Front Vet Sci 10:1026296. technique and RNA-POL II promoter. Pak Vet J 42:346-351.
 546 Pak Vet J, 2024, 44(3): 539-546.

Molouki A, and Peeters B, 2017. Rescue of recombinant newcastle Swayne DE, Suarez DL, Schultz-Cherry S, et al., 2003. Recombinant
disease virus: current cloning strategies and RNA polymerase paramyxovirus type 1-avian influenza-H7 virus as a vaccine for
provision systems. Archi Virol 162:1-12. protection of chickens against influenza and newcastle disease.
Nagy A, Lee J, Mena I, et al., 2016. Recombinant newcastle disease virus Avian Dis 47:1047-1050.
expressing H9 HA protects chickens against heterologous avian Tian KY, Guo HF, Li N, et al., 2020. Protection of chickens against
influenza H9N2 virus challenge. Vaccine 34:2537-2545. hepatitis-hydropericardium syndrome and newcastle disease with
Nakaya T, Cros J, Park MS, et al., 2001. Recombinant newcastle disease a recombinant newcastle disease virus vaccine expressing the fowl
virus as a vaccine vector. J Virol 75:11868-11873. adenovirus serotype 4 fiber-2 protein. Vaccine 38:1989-1997.
Peacock THP, James J, Sealy JE, et al., 2019. A global perspective on Toro H, Zhao W, Breedlove C, et al., 2014. Infectious bronchitis virus
H9N2 avian influenza virus. Viruses 11:620. S2 expressed from recombinant virus confers broad protection
Peeters BP, Leeuw OSD, Koch G, et al., 1999. Rescue of newcastle against Challenge. Avian Dis 58:83-89.
disease virus from cloned cDNA: evidence that cleavability of the Van Dijk M, Morley T, Rau ML, et al., 2021. A meta-analysis of projected
fusion protein is a major determinant for virulence. J virol global food demand and population at risk of hunger for the
73:5001-5009. period 2010-2050. Nat Food 2:494-501.
Qiao Q, Song M, Song C, et al., 2021. Single-dose vaccination of Veits J, Wiesner D, Fuchs W, et al., 2006. Newcastle disease virus
recombinant chimeric newcastle disease virus (NDV) laSota expressing H5 hemagglutinin gene protects chickens against
vaccine strain expressing infectious bursal disease virus (IBDV) newcastle disease and avian influenza. Proc Natl Acad Sci USA
VP2 gene provides full protection against genotype VII NDV and 103:8197-8202.
IBDV challenge. Vaccines 9:1483. Vilela J, Rohaim MA, and Munir M, 2020. Application of CRISPR/Cas9 in
Rautenschlein S, and Schat KA, 2024. The immunological basis for understanding avian viruses and developing poultry vaccines. Front
vaccination. Avian dis 67:366-379. Cell Infect Microbiol 10:581504.
Ravikumar R, Chan J, and Prabakaran M, 2022. Vaccines against major Xu X, Xue C, Liu X, et al., 2019. A novel recombinant attenuated
poultry viral diseases:strategies to improve the breadth and newcastle disease virus expressing H9 subtype hemagglutinin
protective efficacy. Viruses 14:1195. protected chickens from challenge by genotype VII virulent
Romanutti C, Keller L, and Zanetti FA, 2020. Current status of virus- newcastle disease virus and H9N2 avian influenza virus. Vet
vectored vaccines against pathogens that affect poultry. Vaccine Microbiol 228:173-180.
38:6990-7001. Yan Y, and Samal SK, 2008. Role of intergenic sequences in newcastle
Roomer-Oberdo A, Mundt E, Mebatsion T, et al., 1999. Generation of disease virus rna transcription and pathogenesis. J Virol 82:1323-
recombinant lentogenic newcastle disease virus from CDNA. J 1331.
Gen Virol 80:2987-2995. Yang H, Tian J, Zhao J, et al., 2024. The application of newcastle disease
Roth JA, and Sandbulte MR, 2021.The role of veterinary vaccines in virus (NDV): vaccine vectors and tumor therapy. Viruses 16:886.
livestock production, animal health, and public health. In veterinary Yang W, Liu X, and Wang X, 2023. The immune system of chicken and
vaccines:principles and applications; Metwally S, Viljoen J, and its response to H9N2 avian influenza virus. Vet Q 43:1-14.
Idrissi AE, (eds), Wiley online library, USA, pp:1-10. Yehia N, Salem HM, Mahmmod Y, et al., 2023. Common viral and
Shirvani E, Paldurai A, Manoharan VK, et al., 2018. A recombinant bacterial avian respiratory infections:an updated review. Poult Sci
newcastle disease virus (NDV) expressing S protein of infectious 102:102553.
bronchitis virus (IBV) protects chickens against IBV and NDV. Sci Zhang T, Liu Y, Wang H, et al., 2016. Recombinant NDV expressing
Rep 8:11951. cytokines or fliC confers a quick immune response against NDV
Song Q, Cao Y, Li Q, et al., 2011. Artificial recombination may influence challenge and resistance to maternal antibody. Vet Microbiol
the evolutionary analysis of newcastle disease virus. J Virol 196:107-117.
85:10409 -10414. Zhao W, Spatz S, Zhang Z, et al., 2014. Newcastle disease virus (NDV)
Steglich C, Grund C, Ramp K, et al., 2013. Chimeric newcastle disease recombinants expressing infectious laryngotracheitis virus (ILTV)
virus protects chickens against avian influenza in the presence of glycoproteins GB and GD protect chickens against ILTV and NDV
maternally derived ndv immunity. PLoS ONE 8:e72530. challenges. J Virol 88:8397-8406.
Subedi D, Farhan MHR, Niraula A, et al., 2024. Avian influenza in low Zhao W, Zhang Z, Zsak L, et al., 2015. P and M gene junction is the
and middle-income countries (LMICs): outbreaks, vaccination optimal insertion site in newcastle disease virus vaccine vector for
challenges, and economic impact. Pak Vet J 44:9-17. foreign gene expression. J Gen Virol 96:40-45.