0% found this document useful (0 votes)
16 views6 pages

Distribution and Molecular Characterization of Carrying A New Type of Gene

This study identifies a new type of fimA gene (type V) in Porphyromonas gingivalis, a bacterium associated with adult periodontitis. The new fimA variant was found in 16.4% of periodontitis patients and showed distinct molecular characteristics compared to previously identified fimA types. The findings suggest that fimA genotyping could aid in understanding the pathogenicity of P. gingivalis in periodontal disease.

Uploaded by

Erwin Gunawan
Copyright
© © All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as PDF, TXT or read online on Scribd
0% found this document useful (0 votes)
16 views6 pages

Distribution and Molecular Characterization of Carrying A New Type of Gene

This study identifies a new type of fimA gene (type V) in Porphyromonas gingivalis, a bacterium associated with adult periodontitis. The new fimA variant was found in 16.4% of periodontitis patients and showed distinct molecular characteristics compared to previously identified fimA types. The findings suggest that fimA genotyping could aid in understanding the pathogenicity of P. gingivalis in periodontal disease.

Uploaded by

Erwin Gunawan
Copyright
© © All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as PDF, TXT or read online on Scribd
You are on page 1/ 6

JOURNAL OF CLINICAL MICROBIOLOGY, May 2000, p. 1909–1914 Vol. 38, No.

5
0095-1137/00/$04.00⫹0
Copyright © 2000, American Society for Microbiology. All Rights Reserved.

Distribution and Molecular Characterization of Porphyromonas


gingivalis Carrying a New Type of fimA Gene
ICHIRO NAKAGAWA,* ATSUO AMANO, RICHARD K. KIMURA, TAKAYUKI NAKAMURA,
SHIGETADA KAWABATA, AND SHIGEYUKI HAMADA
Department of Oral Microbiology, Osaka University Faculty of Dentistry, Suita-Osaka 565-0871, Japan
Received 30 November 1999/Returned for modification 7 February 2000/Accepted 22 February 2000

Fimbriae of Porphyromonas gingivalis are filamentous appendages on the cell surface and are thought to be
one of the virulence factors. The fimA gene encoding the subunit protein of fimbriae, fimbrillin (FimA), was
classified into four typeable variants (types I to IV). We previously examined the distribution of P. gingivalis in
terms of fimA genotypes in periodontitis patients using a fimA type-specific PCR assay. However, some patients
harbored P. gingivalis with untypeable fimA. In this study, we have cloned a new type (type V) of fimA from
dental plaque samples. P. gingivalis with type V fimA was isolated from dental plaque of a periodontitis patient,
and the isolate was named HNA-99. The deduced amino acid sequences were compared with those of type I P.
gingivalis ATCC 33277, type II strain HW24D1, type III strain 6/26, and type IV strain HG564, and the
homologies were found to be 45, 44, 43, and 55%, respectively. Southern blot analysis showed that the clinical
isolate HNA-99 possessed P. gingivalis-specific genes sod and kgp. However, in terms of serological specificities,
type V FimA showed a difference from other types of FimA. In addition, type V P. gingivalis bacteria were
detected in 16.4% (12 of 73) of the P. gingivalis-positive patients with periodontitis by PCR assay using specific
primers. Thus, a new type of fimA gene is now established, and the fimA genotyping could be useful in
determining the disease-associated genotypes of P. gingivalis involved in the development of adult periodontitis.

Adult periodontitis is a chronic infection of the periodon- was 6.3% of the dental plaque samples from periodontitis
tium that results in periodontal destruction and alveolar bone patients. These data indicate that unknown fimA genes could
loss (11, 32). Porphyromonas gingivalis, a gram-negative and exist within the P. gingivalis strains, and those untypeable or-
black-pigmented anaerobe, has been etiologically associated ganisms may affect the development and progression of peri-
with various types of periodontal diseases including adult pe- odontitis. In this study, we cloned a new type of the fimA gene
riodontitis (1, 2). The organism expresses a number of poten- from the untypeable fimA specimens, and we isolated a P.
tial virulence factors, which have been implicated in the patho- gingivalis strain carrying a new fimA gene.
genesis of adult-onset periodontitis (18). P. gingivalis fimbriae
have been reported to exhibit a wide variety of biological and MATERIALS AND METHODS
immunological activities and are recognized as a major viru- Bacterial strains. P. gingivalis strains ATCC 33277 (fimA type I), HW24D1
lence factor in the infection and pathogenesis of this organism (fimA type II), 6/26 (fimA type III), and HG564 (fimA type IV) were selected
(5, 17, 24). from our culture collections. These organisms were grown in GAM broth (Nissui,
Tokyo, Japan) supplemented with 5 ␮g of hemin per ml and 1 ␮g of menadione
Several studies have demonstrated a divergence in in vitro per ml anaerobically (80% N2, 10% H2, and 10% CO2) at 37°C. For the binding
pathogenicities among strains of P. gingivalis when evaluated assay, these organisms were grown anaerobically in tryptic soy (TS) broth (Difco,
by subcutaneous injection of the organism into rodents (15, 16, Detroit, Mich.) supplemented with hemin and menadione. Escherichia coli
25, 33). Other approaches have included serological and ge- XL10-Gold (Stratagene, La Jolla, Calif.) was cultured in Luria-Bertani medium
or on a Luria-Bertani agar plate supplemented with 100 ␮g of ampicillin per ml
netic typing to examine the relationship of P. gingivalis and its for cloning and sequencing of the cloned gene. For isolation of P. gingivalis from
periodontal pathogenicity (10, 16, 17, 19, 26, 29, 30). However, clinical specimens, TS agar (Difco) supplemented with 5% rabbit blood, hemin,
no clear relationship between experimental dermal infections and menadione (TS blood agar) was used.
and oral infections was demonstrated regarding the virulence Clinical specimens. Subgingival plaque samples were collected from patients
with periodontitis. These subjects were enrolled with informed consent (6). The
capability of P. gingivalis. bacterial genomic DNA from plaque samples was isolated with a DNA isolation
Recently, we examined the distribution of P. gingivalis in kit according to the manufacturer’s instructions (Puregene; Gentra Systems,
periodontitis patients using genotyping of the fimA gene, which Minneapolis, Minn.), and the isolated DNA was dissolved in 100 ␮l of TE (10
encodes fimbrillin (FimA), a subunit protein of fimbriae of this mM Tris HCl [pH 8.0] and 1 mM EDTA) buffer. The clinical parameters of the
patients were described in our previous study (6).
organism (6). These results indicated that the occurrence of Cloning of a new fimA gene by PCR. Among 73 samples which were positive for
the organisms with different fimA genotype distributions the P. gingivalis 16S rRNA gene in our previous study (6), five clinical specimens
showed a clear relationship with periodontal destruction, and were found to contain an untypeable fimA gene(s). Thus, these five samples were
P. gingivalis with type II fimA was found to be significantly used as templates for a new fimA gene. Oligonucleotides M11 (AATCTGAAC
GAACTGCGACGCTAT) and M12 (CTCCCTGTATTCCGAATATAGAC)
predominant in severe periodontitis patients. The investigation were designed for amplification of the fimA gene with the open reading frame
also revealed the existence of a P. gingivalis strain(s) untype- (ORF) and promoter region according to the sequences of the fimA genes
able by our PCR assay, which enables us to divide fimA genes reported previously (14). The PCR amplification was performed in a total vol-
into four types, and the prevalence of the untypeable strain(s) ume of 50 ␮l consisting of 0.2 ␮M (each) primer, 5 ␮l of template DNA, and 2.5
U of ExTaq (Takara Shuzo, Otsu, Japan) according to the manufacturer’s in-
structions. The amplification reaction was performed in a model 9700 thermal
cycler (PE Applied Biosystems, Branchburg, N.J.) with the following cycling
* Corresponding author. Mailing address: Department of Oral Mi- parameters: an initial denaturation at 95°C for 5 min; 30 cycles consisting of 94°C
crobiology, Osaka University Faculty of Dentistry, Suita-Osaka 565- for 30 s, 55°C for 30 s, and 72°C for 1 min; and a final extension at 72°C for 7 min.
0871, Japan. Phone: 81-6-6879-2879. Fax: 81-6-6878-4755. E-mail: The PCR products were separated by electrophoresis using a 1% agarose gel,
[email protected]. and the amplified DNA (about 1.3 kb) was extracted using QIAEX (Qiagen,

1909
1910 NAKAGAWA ET AL. J. CLIN. MICROBIOL.

Düsseldorf, Germany). The DNA was directly cloned into pGEM-T vector Kramer test were used for statistical analysis of comparison of binding abilities
(Promega, Madison, Wis.). The nucleotide sequence of the cloned gene was (P ⬍ 0.01).
determined by using a dye-terminator reaction with a model 310 Genetic Ana- Nucleotide sequence accession number. The type V fimA gene sequence is
lyzer (PE Applied Biosystems). available from GenBank (accession no. AB027294).
Data analysis of nucleotide sequence and amino acid sequence. Data analyses
of nucleotide sequences and deduced amino acid sequences were performed with
GeneWorks software (IntelliGenetics, Mountain View, Calif.). Multiple align- RESULTS
ment analysis and construction of a phylogenetic tree were performed with
CLUSTAL W in the DNA Data Bank of Japan (DDBJ; Mishima, Japan) (28).
Cloning of a new type of fimA. Cloning of a new fimA gene
The sequence data for the fimA genes of P. gingivalis 381 (type I fimA), ATCC was carried out using a pair of PCR primers, M11 and M12.
33277 (type I), BH18/10 (type I), HW24D1 (type II), OMZ314 (type II), Five out of 73 plaque samples containing P. gingivalis that
OMZ409 (type II), ATCC 49417 (type II), 6/26 (type III), and HG564 (type IV) possessed untypeable fimA genes were used as templates. An
were obtained from DDBJ under accession no. D17794, D17795, D17796, expected-size DNA fragment was amplified by PCR from three
D17797, D17798, D17799, D17800, D17801, and D17802, respectively.
Prevalence of fimA type-specific P. gingivalis in periodontitis patients. Supra- of these samples. After cloning of PCR products into pGEM-T
and subgingival plaque samples were taken from a total of 93 periodontitis vector, the nucleotide sequences were determined for at least
patients in our previous study (6). The plaque samples were then processed to five individual clones from each sample. The sequences of all
isolate bacterial DNA as described previously (6). The isolated DNA was dis- the clones were found to be identical (data not shown). The
solved in 100 ␮l of TE buffer at 65°C for 10 min and then stored at ⫺20°C until
use. The detection of P. gingivalis and fimA typing were performed as described
multiple alignment analysis showed that this gene fragment has
previously (6). The specificities and sensitivities of the fimA genotype-specific sequence homology with type I fimA (strain ATCC 33277)
sets (types I to IV) for the primers have been previously demonstrated (6). A (49%), type II fimA (strain HW24D1) (49%), type III fimA
ubiquitous primer set that matches almost all bacterial 16S rRNA genes was used (strain 6/26) (52%), and type IV fimA (strain HG564) (59%).
as a positive control, and the P. gingivalis species-specific primers (16S rRNA)
were used for fimA typing. All primers were purchased from Amersham Phar-
This gene fragment contained a ⫺10 region (⫺35 to ⫺40) and
macia Biotech (Tokyo, Japan). PCR was performed as described previously (6). a ⫺35 region (⫺58 to ⫺63) upstream of the putative initiation
To demonstrate the presence of P. gingivalis with a new, genotype V fimA gene, codon, which are essential for expression of the fimA gene of P.
type-specific primers were constructed as follows; fimV-f, AACAACAGTCTC gingivalis (34). This promoter sequence was found to be con-
CTTGACAGTG; fimV-r, TATTGGGGGTCGAACGTTACTGTC. The speci- served among all fimA types. The comparison of the deduced
ficities of the prospective primers were tested by the program Amplify (21), and
no amplification was detected for any of the strains listed in our previous report amino acid sequences of type V fimA and other types of fimA
(6) other than the prospective positive samples (data not shown). is shown in Fig. 1. Type V FimA has an 18-amino-acid putative
Isolation of P. gingivalis with a new type of fimA gene. Subgingival plaque signal sequence, and this region was very similar to that of type
samples containing P. gingivalis with the type V fimA gene were spread onto TS IV FimA (strain HG564). However, the sequence of type V
blood agar following dilution with phosphate-buffered saline and cultured anaer-
obically for 5 days at 37°C. Black-pigmented colonies were directly screened by
FimA was considerably different from those of other strains.
using PCR with the specific primers (6). The clinical isolates were further ex- The percent homologies of type V FimA with type I FimA
amined by Gram staining and for anaerobic growth, the inability to ferment (strain ATCC 33277), type II (HW24D1), type III (6/26), and
glucose, and the production of indole. The obtained isolate was maintained in type IV (strain HG564) were 42, 41, 40, and 52%, respectively.
GDO medium (group of difficult organisms medium; Nissui).
The phylogenetic tree showed that type IV fimA (strain
Analysis of genes of P. gingivalis strains. Southern blot analysis was performed
as described by Ausubel et al. (7). Total genomic DNAs from lysozyme lysates of HG564) and type V fimA made a cluster, but the branch length
the organisms were digested with EcoRI, BamHI, or HindIII (New England between type IV and type V (0.466) was longer than those
Biolabs, Beverly, Mass.), and the DNA fragments separated by 1% agarose gel between type I and type II (0.231) and type I and type III
electrophoresis were transferred to a nylon membrane (GeneScreen; NEN, Bos- (0.270) (Fig. 2).
ton, Mass.). The fimA gene (1.3 kb) was amplified from genomic DNA of P.
gingivalis ATCC 33277 with the M11 and M12 primers. The sod (superoxide Isolation and characterization of P. gingivalis carrying the
dismutase; 575-bp) and kgp (Lys-gingipain; 560-bp) genes were amplified from type V fimA gene. The distribution of P. gingivalis with type V
the genomic DNA of the organism. These genes were then radiolabeled with fimA was examined in plaque samples from 73 periodontitis
[␣-32P]dCTP (Amersham Pharmacia Biotech) by using the BcaBest DNA label- patients carrying P. gingivalis by PCR using the type V fimA-
ing kit (Takara Shuzo). The blotted membranes were prehybridized and hybrid-
ized according to the protocol described by the manufacturer (NEN). After
specific primers and the four previous fimA type-specific prim-
hybridization, the membranes were washed in 1⫻ SSPE (180 mM NaCl, 10 mM ers (6). Type V fimA P. gingivalis was detected, solely or in
NaPO4, 1 mM EDTA, pH 7.4) at room temperature twice and washed in 0.1⫻ combination with other types, in 16.4% of the samples. The
SSPE for 20 min at 65°C. The washed membranes were exposed to Kodak total incidence of type V fimA was higher than that of type I
BioMax MR films for 2 h at ⫺70°C with an intensifying screen. but was almost the same as that of type IV (Table 1).
Immunoreactivity of FimA. Bacterial cells were harvested by centrifugation at
5,000 ⫻ g for 10 min and washed twice with ice-cold phosphate-buffered saline. We next attempted to isolate P. gingivalis carrying the type V
The cells were resuspended in sodium dodecyl sulfate (SDS) gel loading buffer fimA gene from clinical specimens. A positive PCR gave a
(7) and boiled for 5 min. The cellular proteins were separated by SDS–12% single band with the expected size (462 bp) as assessed by
polyacrylamide gel electrophoresis and were transferred onto a polyvinylidene electrophoresis (data not shown). Several isolates were ob-
difluoride membrane (Immobilon; Millipore, Bedford, Mass.) at 24 mA for 1.5 h.
The transferred protein bands were reacted with rabbit antibodies to recombi-
tained by colony PCR assay with P. gingivalis 16S rRNA-spe-
nant FimA (rFimA) derived from strain 381 (type I fimA) and strain HG564 cific primers and type V fimA-specific primers. One of these
(type IV fimA) antibodies, respectively. The reactions were visualized using an isolates was designated strain HNA-99.
alkaline phosphatase-conjugated anti-rabbit immunoglobulin G antibody (New Southern hybridization analysis of digested genomic DNAs
England Biolabs) and 5-bromo-4-chloro-3-indolylphosphate–nitroblue tetrazo-
lium substrate (Moss Inc., Pasadena, Md.).
from various P. gingivalis strains representing types I to V of
Assay for binding of P. gingivalis cells to saliva-coated hydroxyapatite (sHA) fimA was performed (Fig. 3). The intensity of hybridization
beads. Abilities of P. gingivalis cells to bind sHA beads were examined as de- obtained was similar among all the tested strains, except for
scribed previously (3). Briefly, HA beads (3 mg) were incubated with 300 ␮l of strain HNA-99, when probed with the 32P-labeled fimA gene of
clarified human whole saliva in silicon-coated borosilicate tubes at 25°C for 18 h. ATCC 33277 (type I). The genomic DNA from HNA-99
For determination of specific binding of salivary proteins, HA beads (3 mg) were
incubated with buffered KCl (pH 6.8) for the same periods. The sHA and showed a weak hybridization with this probe but was reactive
uncoated HA beads were washed twice with buffered KCl and incubated with 106 with the sod and kgp gene fragments from ATCC 33277 with a
to 108 3H-labeled cells at room temperature for 1 h. After incubation, the signal intensity similar to those of other strains.
reaction mixture was layered on 1.5 ml of 100% Percoll (Amersham Pharmacia Western blot analysis revealed that the 41-kDa FimA of
Biotech) in a new siliconized borosilicate tube to separate unbound cells. The
radioactivities of the cell-bound beads were determined in a liquid scintillation
strain HNA-99 did not react with anti-rFimA of strain 381
counter (model 1401; LKB, Uppsala, Sweden). The assay was performed in (type I). On the other hand, FimA of strain HNA-99 was
triplicate and repeated three times. One-way analysis of variance and the Tukey- faintly reactive against anti-rFimA of strain HG564 (type IV)
VOL. 38, 2000 CHARACTERIZATION OF P. GINGIVALIS WITH TYPE V fimA 1911

FIG. 1. Comparison of predicted amino acid sequences for FimAs encoded by the fimA genes of various P. gingivalis strains and type V fimA gene. Amino acid
identities are shown by asterisks. Hyphens are used to indicate the positions of gaps in the multiple alignment. The putative signal peptides are underlined. The number
of amino acids and the molecular weight of the FimA of each strain are given. The alignment of the deduced amino acid sequences was performed with the CLUSTAL
W program of the DNA Data Bank of Japan.

(Fig. 4). The immunogenicity of the HNA-99 FimA was clearly cidation of the attachment mechanisms have been extensively
different from those of type I, type II, and type III FimAs, attempted (17). Here, we have successfully cloned a type V
although a weak cross-reaction was found between type IV and fimA gene, a new genotype of the fimbrillin gene of P. gingi-
type V FimAs. valis, and have isolated the organism carrying this gene. P.
Binding of P. gingivalis cells to salivary components. To gingivalis FimAs were classified into four types on the basis of
determine whether the variation of FimA types could be re- the first 20 N-terminal amino acids (20) and variations in the
lated to functional ability, levels of binding of P. gingivalis nucleotide sequences of the fimA gene (14). As shown in Re-
organisms to HA beads coated with whole saliva were com- sults, the multiple alignment analysis showed that our cloned
pared. As shown in Fig. 5, P. gingivalis strains ATCC 33277 gene fragment has sequence homology of 49 to 52% with other
(type I) and HW24D1 (type II) strongly bound to sHA beads, types of fimA genes. The highly homologous sequence strongly
while strains 6/26 (type III), HG564 (type IV), and HNA-99 suggests that it is a new type of P. gingivalis fimA gene, and we
(type V) showed weak binding capabilities. designated it type V fimA.
P. gingivalis possessing the type V fimA gene was detected
DISCUSSION with a higher frequency (total, 16.4%) than were type I fimA
organisms (13.7%) in the present cohort. This finding suggest
Since fimbriae appear to be important for attachment and that the present type of P. gingivalis is involved in the etiology
invasion by P. gingivalis, characterization of fimbriae and elu- of periodontitis. A wide variety of studies suggested that P.
1912 NAKAGAWA ET AL. J. CLIN. MICROBIOL.

FIG. 2. Evolutionary relationships based on synonymous site variation in the


fimA gene of P. gingivalis. The neighbor-joining method was used to construct the
phylogenetic tree, using CLUSTAL W (DNA Data Bank of Japan) and Tree-
View software (http://taxonomy.zoology.gla.ac.uk/rod/treeview.html).

gingivalis fimbriae are major virulence factors and are possible


candidates for use in a vaccine (17). Thus, we attempted fur-
ther characterization of the isolate in this study.
Interestingly, analyzing the promoter region of fimA shows
that the type V fimA gene shares the identical 5⬘ upstream
(promoter region) and 3⬘ downstream regions of the ORF with
FIG. 3. Southern blot analyses of P. gingivalis specific genes. Genomic DNA
the other types of fimA genes (data not shown). This promoter was isolated from each strain; digested with EcoRI, BamHI, and HindIII; and
region is essential for the expression of FimA (34), and the then separated on a 1% agarose gel. After blotting to a nylon membrane, P.
gene expression is tightly regulated by environmental condi- gingivalis specific genes were probed with 32P-labeled fimA, sod, and kgp gene
tions (4, 33); these observations also support the view that it is fragments from strain ATCC 33277. Lanes: 1, ATCC 33277; 2, HW24D1; 3, 6/26;
4, HG564; 5, HNA-99.
a new type of fimA gene in P. gingivalis. In addition, the phy-
logenetic tree revealed that the genetic distances of the fimA
gene among P. gingivalis strains were less than 0.5. Boyd et al.
(9) reported that the fimA gene of Salmonella enterica was strains were derived from a common ancestor, even though the
hypervariable among natural isolates and that the genetic dis- branch lengths between the tested strains are different (Fig. 2).
tance between subspecies IV and VII was 0.87, still suggesting Southern blot analysis revealed that the hybridization pat-
a common ancestor. In this context, the genetic distance of 0.5 terns resembled each other for all strains when probed with the
strongly suggests that the fimA gene clusters of P. gingivalis type I fimA gene, while the hybridization intensity was weak
with strain HG564 (type IV) and only faint bands were ob-
served for strain HNA-99 (type V) (Fig. 3). Loos and Dyer (21)
used probe 1 (855-bp fragment of the internal fimA381 coding
TABLE 1. Distribution of P. gingivalis with type I to V fimA in 73 sequence) and probe 2 (2.5-kb fragment including the ORF as
clinical samples from periodontitis patients well as about 800 bp flanking each side of the ORF) for re-
fimA type(s)
Frequency of occurrence striction fragment length polymorphism analyses. The results
(% of the total samples) showed that probe 1 hybridized only rarely with the fimA gene
I .............................................................................................. 5.5 of strains W50, W12, 9-14K-1, AJW-1, and HG564, while
II.............................................................................................52.1 probe 2 hybridized with all samples. Our fimA probe included,
III ........................................................................................... 6.8 in addition to the fimA sequence, a short-ended 200-bp flank-
IV ........................................................................................... 9.6 ing sequence, which could have been the cause for the weak
V............................................................................................. 2.7 hybridization with the samples of strains HG564 and HNA-99.
I and II .................................................................................. 6.8 On the other hand, other P. gingivalis-specific genes, sod and
I and V .................................................................................. 1.4 kgp, could hybridize with all the test samples with similar signal
II and IV ............................................................................... 2.7 intensities (Fig. 3). These results suggest that the fimA diversity
II and V................................................................................. 8.2
IV and V ............................................................................... 4.1
is most likely generated through mutation and genetic ex-
change within the ORF but not in the promoter region of the
VOL. 38, 2000 CHARACTERIZATION OF P. GINGIVALIS WITH TYPE V fimA 1913

known. Further studies are needed for analysis of the genetic


diversity of the fimA gene of P. gingivalis.
Western blot analysis using antisera against rFimA of strains
381 and HG564 indicated that the immunoreactivity of type V
FimA was significantly different from those of other strains. It
should be noted that a 41-kDa protein from strain HNA-99
was very faintly reactive with the anti-HG564 rFimA antibody.
Our previous study revealed that the fimA gene of HG564 was
considerably different from that of 381 and that the type IV
rFimA did not clearly react with anti-rFimA (type I) antibody
(14). These results indicate that the antigenic variation of fim-
briae of P. gingivalis may depend on some specific epitope of
FimA. It was reported that the immune response against FimA
was enhanced by immunization with the synthetic peptide
FIG. 4. Western blot analyses of the FimAs in five type-representative strains
of P. gingivalis. Whole-cell lysates of P. gingivalis (2 ⫻ 107 cells) were separated
FP381(201-221) in guinea pigs (26) and that the synthetic pep-
by SDS–12% polyacrylamide gel electrophoresis. After electrophoresis, gels were tide PgF-P8 could induce a protective immune response in a
transferred to polyvinylidene difluoride membranes and FimA was detected with chamber infection model using mice (12). These antigenic
antibodies to rFimA (381, type I fimA [A], and HG564, type IV fimA [B]). Lanes: epitopes are conserved among type I, II, and III fimA strains
M, prestained protein marker; 1, P. gingivalis ATCC 33277; 2, P. gingivalis
HW24D1; 3, P. gingivalis 6/26; 4, P. gingivalis HG564; 5, P. gingivalis HNA-99.
but not in the type IV and V organisms. The differences in
Arrows indicate FimA. immunoreactivity may influence the pathogenicity of P. gingi-
valis strains. In addition, serum antibody responses against
type V FimA in periodontitis patients are not yet known. The
purification of type V FimA and the antibody responses to type
fimA gene. The process of antigenic variation through gene
V FimA are now under investigation in our laboratory.
cassette recombination has been shown for the pathogenic
The activity of P. gingivalis HNA-99 binding to salivary pro-
Neisseria species (20); however, multiple fimA alleles within a
teins was almost 50% of that of P. gingivalis ATCC 33277 (Fig.
single strain were not observed for P. gingivalis strains (Fig. 3).
5). The site of active binding of P. gingivalis fimbriae to salivary
Furthermore, the phase variation of type 1 fimbriation in E.
proteins has been examined by using whole saliva-coated HA
coli is controlled by the site-specific DNA inversion of recom-
beads (3). The C-terminal region between amino acids 226 and
binases (8), but the site-specific inversion was not found in
337 of FimA of strain 381 was essential for the binding of the
phase variation of fimA gene expression (34). These observa-
organism to salivary components (20), and synthetic peptide
tions also supported the concept that the genetic variation of
FimA (amino acids 266 to 286) could inhibit the P. gingivalis
fimA has occurred within the ORF in P. gingivalis; however, the
whole-cell binding to whole saliva (23). These regions are con-
mechanism of genetic exchange of the fimA gene is still un-
served between type I and type II FimA, but only 10 amino
acids are conserved in type IV and type V FimAs. The differ-
ences in amino acid compositions of the C-terminal region may
reflect the ability of FimA to bind salivary components.
Taking all data into consideration, we conclude that the type
V fimA is a new type of P. gingivalis fimA gene. However, the
immunoreactivity of type V FimA is significantly different from
those of other known types of FimA. Since the fimA genotyp-
ing assay enables us to differentiate disease-associated and
nonassociated clones of P. gingivalis, further studies are needed
to establish the association of type V P. gingivalis with peri-
odontal diseases.

ACKNOWLEDGMENTS
We thank K. Kataoka and M. Kuboniwa for help in the collection of
clinical samples. We also thank S. Morishima for his generous gift of
rFimA-specific antibodies.
This work was supported by grant-in-aid C-10671933 from the Min-
istry of Education, Science and Culture of Japan.

REFERENCES
1. Albandar, J. M., L. J. Brown, R. J. Genco, and H. Löe. 1997. Clinical
classification of periodontitis in adolescents and young adults. J. Periodontol.
68:545–555.
2. Albandar, J. M., L. J. Brown, and H. Löe. 1997. Putative periodontal patho-
FIG. 5. Binding of P. gingivalis representing the five different fimA types to gens in subgingival plaque of young adults with and without early-onset
HA and sHA beads. Three milligrams of HA beads equilibrated with buffered periodontitis. J. Periodontol. 68:973–981.
KCl or clarified whole human saliva was added to a siliconized borosilicate tube 3. Amano, A., H. T. Sojar, J. Y. Lee, A. Sharma, M. J. Levine, and R. J. Genco.
and incubated with different numbers of the 3H-labeled P. gingivalis (106 to 108) 1994. Salivary receptors for recombinant fimbrillin of Porphyromonas gingi-
cells in a total volume of 300 ␮l with a gentle, oscillating motion for 1 h at room valis. Infect. Immun. 62:3372–3380.
temperature. The mixture was layered on 100% Percoll to separate unbound 4. Amano, A., A. Sharma, H. T. Sojar, H. K. Kuramitsu, and R. J. Genco. 1994.
cells from the bead-bound cells. After washing, radioactivity of the bead-bound Effects of temperature stress on expression of fimbriae and superoxide dis-
cells was quantitated with a liquid scintillation counter. The results are shown as mutase by Porphyromonas gingivalis. Infect. Immun. 62:4682–4685.
the mean values of triplicate samples from three individual experiments. One- 5. Amano, A., T. Nakamura, S. Kimura, I. Morisaki, I. Nakagawa, S. Kawa-
way analysis of variance and the Tukey-Kramer test were used for the compar- bata, and S. Hamada. 1999. Molecular interactions of Porphyromonas gingi-
ison of the binding abilities of P. gingivalis cells (ⴱ, P ⬍ 0.0001). valis fimbriae with host proteins: kinetic analyses based on surface plasmon
1914 NAKAGAWA ET AL. J. CLIN. MICROBIOL.

resonance. Infect. Immun. 67:2399–2405. 20. Lee, J. Y., H. T. Sojar, G. S. Bedi, and R. J. Genco. 1991. Porphyromonas
6. Amano, A., I. Nakagawa, K. Kataoka, I. Morisaki, and S. Hamada. 1999. (Bacteroides) gingivalis fimbrillin: size, amino-terminal sequence, and anti-
Distribution of Porphyromonas gingivalis strains with fimA genotypes in pe- genic heterogeneity. Infect. Immun. 59:383–389.
riodontitis patients. J. Clin. Microbiol. 37:1426–1430. 21. Loos, B. G., and D. W. Dyer. 1991. Restriction fragment length polymor-
7. Ausubel, F. M., R. Brent, R. E. Kingston, D. D. Moore, J. G. Seidman, J. A. phism analysis of the fimbrillin locus, fimA, of Porphyromonas gingivalis. J.
Smith, and K. Struhl. 1994. Current protocols in molecular biology, section Dent. Res. 71:1173–1181.
2. John Wiley & Sons, Inc., New York, N.Y. 22. Nagata, A., T. Man-yoshi, M. Sato, and R. Nakamura. 1991. Serological
8. Blomfield, I. C., D. H. Kulasekara, and B. J. Eisenstein. 1997. Integration studies of Porphyromonas (Bacteroides) gingivalis and correlation with en-
host factor stimulates both FimB- and FimE-mediated site-specific DNA zyme activity. J. Periodontal Res. 26:184–190.
inversion that controls phase variation of type 1 fimbriae expression in 23. Nagata, H., A. Sharma, H. T. Sojar, A. Amano, M. J. Levine, R. J. Genco.
Escherichia coli. Mol. Microbiol. 23:705–717. 1997. Role of the carboxyl-terminal region of Porphyromonas gingivalis fim-
9. Boyd, E. F., and D. L. Hartl. 1999. Analysis of the type 1 pilin gene cluster brillin in binding to salivary proteins. Infect. Immun. 65:422–427.
fim in Salmonella: its distinct evolutionary histories in the 5⬘ and 3⬘ regions. 24. Nakamura, T., A. Amano, I. Nakagawa, and S. Hamada. 1999. Specific
J. Bacteriol. 181:1301–1308. interactions between Porphyromonas gingivalis fimbriae and human extracel-
10. Califano, J. V., R. E. Schifferle, J. C. Gunsolley, A. M. Best, H. A. Schenkein, lular matrix proteins. FEMS Microbiol. Lett. 175:267–272.
and J. G. Tew. 1999. Antibody reactive with Porphyromonas gingivalis sero- 25. Neiders, M. E., P. B. Chen, H. Suido, H. S. Reynolds, J. J. Zambon, M.
types K1-6 in adult and generalized early-onset periodontitis. J. Periodontol. Shlossman, and R. J. Genco. 1989. Heterogeneity of virulence among strains
70:730–735. of Bacteroides gingivalis. J. Periodontal Res. 24:192–198.
11. Christersson, L. A., C. L. Fransson, R. G. Dunford, and J. J. Zambon. 1992. 26. Ogawa, T. 1994. The potential protective immune responses to synthetic
Subgingival distribution of periodontal pathogenic microorganisms in adult peptides containing conserved epitopes of Porphyromonas gingivalis fimbrial
periodontitis. J. Periodontol. 63:418–425. protein. J. Med. Microbiol. 41:349–358.
12. Deslauriers, M., S. Haque, and P. M. Flood. 1996. Identification of murine 27. Rumpf, R. W., A. L. Griffen, B. G. Wen, and E. J. Leys. 1999. Sequencing of
protective epitopes on the Porphyromonas gingivalis fimbrillin molecule. In- the ribosomal intergenic spacer region for strain identification of Porphy-
fect. Immun. 64:434–440. romonas gingivalis. J. Clin. Microbiol. 37:2723–2725.
13. Engels, E. R. 1993. Contributing software to internet: the Amplify program. 28. Thompson, J. D., D. G. Higgins, and T. J. Gibson. 1994. CLUSTAL W:
Trends Biochem. Sci. 18:448–450. improving the sensitivity of progressive multiple sequence alignment through
14. Fujiwara, T., S. Morishima, I. Takahashi, and S. Hamada. 1993. Molecular sequence weighting, position-specific gap penalties and weight matrix choice.
cloning and sequencing of the fimbrilin gene of Porphyromonas gingivalis Nucleic Acids Res. 22:4673–4680.
strains and characterization of recombinant proteins. Biochem. Biophys. 29. Tran, S. D., and J. D. Rudney. 1996. Multiplex PCR using conserved and
Res. Commun. 197:241–247. species-specific 16S rRNA gene primers for simultaneous detection of Acti-
15. Genco, C. A., D. R. Kapczynski, C. W. Cutler, R. J. Arko, and R. R. Arnold. nobacillus actinomycetemcomitans and Porphyromonas gingivalis. J. Clin. Mi-
1992. Influence of immunization on Porphyromonas gingivalis colonization crobiol. 34:2674–2678.
and invasion in the mouse chamber model. Infect. Immun. 60:1447–1454. 30. Tran, S. D., and J. D. Rudney. 1999. Improved multiplex PCR using con-
16. Grenier, D., and D. Mayrand. 1987. Selected characteristics of pathogenic served and species-specific 16S rRNA gene primers for simultaneous detec-
and nonpathogenic strains of Bacteroides gingivalis. J. Clin. Microbiol. 25: tion of Actinobacillus actinomycetemcomitans, Bacteroides forsythus, and Por-
738–740. phyromonas gingivalis. J. Clin. Microbiol. 37:3504–3508.
17. Hamada, S., A. Amano, S. Kimura, I. Nakagawa, S. Kawabata, and I. 31. Van Steenbergen, T. J., F. G. Delemarre, F. Namavar, and J. De Graaff.
Morisaki. 1998. The importance of fimbriae in the virulence and ecology of 1987. Differences in virulence within the species Bacteroides gingivalis. An-
some oral bacteria. Oral Microbiol. Immunol. 13:129–138. tonie Leeuwenhoek 53:233–244.
18. Holt, S. C., I. Kesavalu, S. Walker, and C. A. Genco. 1999. Virulence factors 32. Williams, R. C. 1990. Periodontal disease. N. Engl. J. Med. 322:373–382.
of Porphyromonas gingivalis. Periodontol. 2000 20:168–238. 33. Xie, H., S. Cai, and R. J. Lamont. 1997. Environmental regulation of fimbrial
19. Laine, M. L., B. J. Appelmelk, and A. J. van Winkelhoff. 1997. Prevalence gene expression in Porphyromonas gingivalis. Infect. Immun. 65:2265–2271.
and distribution of six capsular serotypes of Porphyromonas gingivalis in 34. Xie, H., and R. J. Lamont. 1999. Promoter architecture of the Porphyromo-
periodontitis patients. J. Dent. Res. 76:1840–1844. nas gingivalis fimbrillin gene. Infect. Immun. 67:3227–3235.

You might also like