Research Proposal

Effect of Efflux Pump Expression on Antibiotic Sensitivity Pattern in

Pseudomonas aeruginosa: Phenotypic and Genotypic Profiling in
Peshawar, Pakistan

BY
Abdullah
AUP-22FL-MPHIL-MB-21905

Supervised by

Dr. Kashif Bashir

Research Proposal Submitted to the Department of Health & Biological Sciences,

Abasyn University Peshawar in Partial Fulfillment of the Requirements for the
Degree of Master of Philosophy in Microbiology

Faculty of Life Sciences

Department of Health and Biological Sciences
Abasyn University Peshawar
 Approval Sheet
Evaluation Committee for Proposal (ECP)
This is to certify that the research proposal of Abdullah is on the topic

Effect of efflux pump expression on antibiotic sensitivity pattern in

Pseudomonas aeruginosa: Phenotypic and Genotypic profiling in
Peshawar, Pakistan

Has been recommended by the Evaluation Committee for Proposal for the approval of
competent forum in partial fulfillment of degree of Master of Philosophy in
Microbiology.

Approved by:

Dr. Kashif Bashir __________________________

Assistant Professor
(Supervisor)

Mr. Falak Niaz __________________________

Assistant Professor
Lecturer (Ripah International University)
(Co-Supervisor)

Dr. Muhammad Tayyab __________________________

Assistant Professor, IBGE, The University of Agriculture
(External)

Dr. Zobia Afsheen (HOD) __________________________

Associate Professor
(Convener of ECP)
 Table of Contents

S. No. Title Page No

I INTRODUCTION……………………………………... 1

II REVIEW OF LITERATURE………………………….. 4

III AIM AND OBJECTIVES……………………………… 7

IV SIGNIFICANCE OF THE RESEARCH……………… 8

V MATERIALS AND METHODS……………………… 9

VI REFERENCES………………………………………… 15
 I. INTRODUCTION
Pseudomonas aeruginosa is a rod-shaped, nonacid, motile and heterotrophic
bacterium that is 1–5µm long and 0.5–1µm large. P. aeruginosa is capable of anaerobic
reproduction when given arginine. Additionally, it possesses a small amount of
fermentative qualities, which normally promote very little to no development. The
organism may utilize greater than 100 different living molecules that is sources of carbon
and energy, because it is a prototroph, it can also live on a low salt growth medium with a
minute supply of carbon and energy. P. aeruginosa grows well in temperatures about 37°C,
but it can also survive on temperatures as low as 4°C to 42°C. It is an important soil bacteria
that can break down polycyclic aromatic hydrocarbons (PAH) and is largely developed in
water sources that have been tainted by both people and animals, like sewage and sinks
inside and outside of hospitals (Diggle et al., 2020).

Pseudomonas, an extensive family of free-living bacteria, frequently creates

problems in soil, spring water, and the ocean. P. aeruginosa in particular, tends to grow in
conditions like sewage, dirt, and the ocean, including close to other plants. Despite being
frequently isolated from the marine environment, its apparent distribution has been
observed close to stream outfalls and shoreline (Reineke et al., 2023). The P. aeruginosa
bacteria frequently contribute to infections that occur in patients who are receiving
treatment, including, surgical site infections, urinary tract infections, blood related
infections and pneumonia (Dreier et al., 2015).These opportunistic bacteria called P.
aeruginosa take part in the development of many infectious illnesses that affect people
(Valot et al., 2015).

Three fundamental antibiotic families fluoroquinolones, beta-lactams and

aminoglycosides are used to treat P. aeruginosa infections. Chromosome alterations can
easily provide high levels of compound resistance. Furthermore, P. aeruginosa clinical
isolates frequently acquire resistance genes carried by distinct genomic islands and related
transposons, with approximately 100 different horizontally acquired resistance elements
now identified in ST235 isolates (Roy et al., 2017).

1
 Resistance to antibiotics is limiting our ability to treat a wider spectrum of
infections. The Centers for Disease Control and Prevention predicts in USA that resistant
bacteria result more than 2.8 million sickness and 35,000 fatalities each year. (Tag Eidein
et al., 2021). Around 700,000 people globally die from antibiotic resistance annually, and
some researchers believe that by 2050 if resistance levels continue to climb, 10 million
people will be dead each year (Willyard et al., 2017).

Fewer studies have focused on the potential impact of using non-antibiotic

antimicrobial agents, however, several have addressed the significance of the irrational use
of antibiotics as the primary predictor of the spread of microbial resistance. Non-antibiotic
antimicrobials are frequently used in commercial soaps, detergents, and antiseptics in
addition to being disinfectants and cleaners. Their use can lead to the selection of cross-
antibiotic resistant mutants; for instance, P. aeruginosa exposure to triclosan resulted in
the selection of an MDR strain (Chuanchuen et al., 2001).

Acquired, intrinsic, and adapted resistance are the three major types of resistance
that P. aeruginosa uses to fend against substance onslaughts. Aspects of P. aeruginosa
innate resistance include the outer membrane's poor permeability, the expression of efflux
pumps that eject antibiotics from the cell, and the creation of enzymes to activate antibiotics.
By mutation or horizontal transfer of resistance genes, P. aeruginosa may develop
resistance (Breidenstein et al., 2011). Due to its innate resistance to a number of
antimicrobial drugs and its tendency to develop resistance to other antimicrobial agents
during antimicrobial chemotherapy, there are fewer therapeutic alternatives available
(Abushaheen et al., 2020). Antibiotic resistance is becoming a bigger threat, especially for
illnesses carried on by P. aeruginosa. The overexpression of efflux pump systems which
makes it possible to develop resistance to variety of medications with various fundamental
characteristics, is one of the main mechanisms causing this resistance (Botelho et al., 2019).
P. aeruginosa is infamous for having an elevated degree of antibiotic resistance and
causing illnesses that are challenging to cure (Leylabadlo et al., 2017).

Multidrug Efflux systems are responsible for many of the characteristics of

multidrug resistant (MDR) bacteria. Resistance to antibiotics is caused by transport

2
proteins called efflux pumps, which are responsible for ejecting harmful substances from
cell (Puzari et al., 2017). Gram negative bacteria frequently have resistant symbiosis cell
division of efflux pumps, which is virtually invariably chromosomally encoded (Colclough
et al., 2020). 12 Resistance Nodulation Division (RND) group systems has been identified
in P. aeruginosa. MexCD-OprJ, MexEF-OprN, MexAB-OprM and MexXY (-OprA)
overexpression play a significant impact in decreasing sensitivity to antibiotics across these
systems (Jeannot et al., 2008).

MexAB-OprM is a multidrug efflux protein expressed in the Gram-negative

Pseudomonas aeruginosa. MexA is the membrane fusion protein; MexB is the inner
membrane transporter; and OprM is the outer membrane channel. It is associated with
resistance to fluoroquinolones, chloramphenicol, erythromycin, azithromycin, novobiocin,
and certain β-lactams and lastly over-expression is linked to colistin resistance (Pesingi et
al., 2019).

This study will focus that whether mexA and mexB are involved in efflux pump
expression in P. aeruginosa that are responsible for antibiotic resistance.

3
 II. LITERATURE REVIEW

Rahbar et al. (2021) investigated that RND efflux pumps are the cause of P.
aeruginosa (MDR), which stands for (RND). The goal of that investigation was to assess
how overexpression of RND efflux pumps affected the clinical isolation of P. aeruginosa
antibiotic resistance. They obtained 122 sales from three hospitals in Tehran, iran. The
isolates were identified and evaluated using agar dilution procedures and the disk diffusion
method to ascertain their antibiotic resistance. The study examined the association between
antibiotic resistance and four drug efflux pump systems (MexCD (OprJ, MexAB, OprM,
OprN, MexEF, MexXY and OprA were studied for their gene expression. The isolates
showed that ticarcillin (80%) ciprofloxacin (74%) and meropenem (71%), respectively,
had the highest rates of resistance. MexY and MexB were likely mostly expressed in the
strains under study because the majority of them expressed mex B (68%) mex C (29%)
mexE (42%) and mexY (75%). The ICU wards had a considerably higher prevalence of
mexB and mexY overexpression (p = 0.033). Most anti-pseudomonal drugs were resistant
to cells expressing RND-type efflux pumps.

Gopal et al. (2020) assessed that both innate and acquired resistance to several
antimicrobial medications exist in p. aeruginosa. It aims to demonstrate that clinical soil
contains p. aeruginosa. The Insein General Hospital in the city of Yangon provided the
clinical soil specimens (A and B) for this investigation, and an initial analysis of the
bacteria present in the sample was carried out. By using serial dilution plate method, the
bacteria were isolated from soil samples and then cultivated on nutrient agar media. Gram
staining and microscopic analysis methods were used to obtain and observe that the 3
bacterial strains B-1, B-2, and B-3 from soil. Sample B and the one bacterial strain (A-1)
from soil specimen A. All of the recovered bacterial strains were found to be cream-colored
and rod-shaped in the gram staining test. A-1 was found to be gram positive whereas B-1,
B-2, and B-3 were found to be gram negative. The obtained bacterial strains has been
observe by using biochemical tests such as the methyl red test, motility test, indole test,
citrate test , gelatin test, catalase test, (VP) test, urease test, starch hydrolysis test, and sugar
fermentation test.. Out of four obtain bacterial strains pattern, B-2 was chosen for
identification since it was shown to have Pseudomonas aeruginosa like traits.

4
 Beig et al. (2019) studied that in clinical obtain of Pesudomonas aeruginosa from
intensive care units (ICU), measure the expression of genes associated with the MexAB-
OprM efflux pumps. Since November 2018 to May 2019, 33 sampales in total have been
isolated from patients in ICU units at several hospitals in Hamadan. By employing the
Minimal Inhibitory Concentration (MIC) and disk diffusion techniques for antibiotic
susceptibility of imipenem. An evaluation of MexAB OprM efflux pump gene expression
was conducted using real-time PCR. According to statistical research, Ceftriaxone had a
resistance rate of 21 (63.63%) and piperacillin had a resistance rate of 11 (33.33%). Among
the 33 samples taken from the ICU, A (MIC) test on imipenem revealed that 15 isolates
(43.42%) were resistant and 19 isolates (57.57%) were susceptible. MexB, MexA, and
OprM gene expression were shown to be greater in 21% (4/20), 26% (5/20), and 20% (4/20)
of isolates respectively, when compared to the control strain. One of the most frequent
mechanisms for P. aeruginosa isolates' resistance to carbapenem drugs in various hospital
units, notably intensive care units, is increased expression of the MexAB (OprM) efflux
pump. In order to manage and treat such resistant isolates, identification of Carbapenem
antibiotic resistance mechanisms is necessary.

Shigemura et al. (2015) determined that antibiotic resistant bacteria P. aeruginosa

has a variety of mechanisms. This research aims to evaluate the association between
antibiotic resistance in P. aeruginosa, and the causative factor of UTIs and involved in
expression of efflux gene coding. With complete information on antibiotic (MICs) Real-
time quantitative reverse transcription PCR was conducted on strains of P. aeruginosa
collected from ICU patients. This study shows that the gene impressions of the 4 multi-
drug efflux pump systems with resistance between cell division (MexAB-OprM, MexXY
(-OprA)), MexCD-OprJ, MexEF-OprN ) along with the relationship between the MICs of
9 antibiotics, including risk factors, related genes, and the impression of mexC, mexB,
mexY. and mexE, shows in Increased expression of mexC or mexB was highly associated
with difficult UTI, according to this multivariate statistical data (Odds ratio = 8.87, P =
0.033 & Odds ratio = 8.03, Po0.001 respectively). Additionally, they observe a strong
relationship with mexC expression levels and levofloxacin drug resistance (odds ratio =
4.49, P = 0.036). The study concluded that the increase mexC expression in P. aeruginosa

5
that causative for UTI. Our understanding of the efflux pump system and antibiotic
resistance has been improved by these findings.

Terzi et al. (2014) reported that using qPCR to evaluate the transcription pattern of
efflux pump genes to know about their function in drug resistance. The automated
(bioMerieux, France) Vitek 2 system was used to identify the antibiotic sensitivity.
Depending on their level of drug resistance, isolates were categorized into four groups:
carbapenem and floroquinolone-resistant, obtained of carbapenem-resistant (CR) and
obtain foloroquinolone-resistant and MDR. qPCR was used to evaluate the transcription of
the mexF, mexY mexB, and mexD, genes using a Light Cycler device from Roche
(Germany). With the help of arbitrary PCR, these genetic relation between isolates was
estimated. The recurrence of the over expressed genes were (40% mex Y) (46% mex F)
(76% mex B) and (88% mex D) across the 50 isolates were examined. Mex B had been
increased in 15 of the 22 recognized from the MDR group, mex D in 20 of the 22, mexY
in 19 of the 22, mexF in 15 of the 22, and obtained. Isolation of mex B and mex D in the
ICR group have excessively shows expression. Chloroquine resistant isolates showed mex
D over expression. Mex B and Mex D were over expressed in all twelve isolates in the IQR
group. Seven out of the twelve isolates in this group had mex F overexpression found. By
using AP-PCR, 18 different banding patterns were identified. In the majority of the studied
isolates, elevated mex B transcription was associated with meropenem resistance while
MexEF -OprN MexCD -OprJ and the MexCD -OprJ efflux pump were related to
floroquinolone group resistance. The gentamicin resistance may be attributed to increased
mexY transcription.

6
 III. AIM AND OBJECTIVES

The current study aim to investigate the effect of efflux pump expression on
antibiotic sensitivity pattern in Pseudomonas aeruginosa through phenotypic and
genotypic profiling. The specific objectives are to:

1. Investigate how P. aeruginosa Efflux Pump Expression affects the bacteria's ability
to resist antibiotics.
2. Investigate the correlation between efflux pump expression and antibiotic
resistance patterns to understand MDR phenotypes in P. aeruginosa
3. Characterize the important efflux pump genes (MexAB-OprM) in clinical isolates
of P. aeruginosa.

7
 IV. SIGNIFICANCE OF THE STUDY

Pseudomonas aeruginosa is a notorious opportunistic pathogen known for its

ability to develop resistance to multiple antibiotics. Understanding the mechanisms behind
this resistance is crucial for devising effective treatment strategies. The study's therapeutic
value lies in its potential to transform the management of P. aeruginosa infections by
revealing, through genetic and phenotypic profiling, the influence of efflux pump
expression on drug sensitivity. Improved infection control, less treatment failures, broader
implications for combating antibiotic resistance on a global level, and improved patient
outcomes and public health could all result from this understanding. By combining
phenotypic (observable traits) and genotypic (genetic makeup) profiling, researchers can
gain a comprehensive understanding of how antibiotic resistance develops in P. aeruginosa
strains. This research topic is significant as it contributes to our understanding of antibiotic
resistance mechanisms in P. aeruginosa, with implications for both clinical practice and
public health interventions, particularly in the context of Peshawar, Pakistan.

8
 V. MATERIALS AND METHODS

Study Design and Setting

It will be a laboratory based experimental study design, which will be conducted at
Microbiology Research Laboratory, Abasyn University Peshawar.
Samples Collection
A total of 100 clinical samples of blood, urine and pus will be collected
conveniently from male and female patients in sterile urine bottle with preservative (boric
acid), pus collection swab and blood culture glass bottle from Al-khidmat hospital
Peshawar and will be labeled properly with name, age, gender etc. The samples will be
brought to Microbiology Research Laboratory, Abasyn University Peshawar for further
processing.

Inclusion / Exclusion Criteria

The study will involve clinical isolates of P. aeruginosa from patient samples like
wound swabs, sputum, or urine from both male and female. Isolates must show various
degrees of susceptibility to various antibiotic classes. MDR strains will be evaluated for
efflux pump expression while to maintain data independence and variety, duplicate isolates
from the same patient or source will be disregarded.

Sample Processing
All clinical specimens will be processed according to Clinical and Laboratory
Standards Institute guidelines (2022). All the samples will be processed in strict aseptic
environment Biosafety cabinet (Tasneem et al., 2022).

Isolation and Identification of Clinical Specimens

The samples will be cultured for bacterial cultivation, specifically Blood Agar and
MacConkey Agar plates. These plates will then be smeared with the samples and incubated
aerobically at 37°C for 24 to 48 hours. A combination of techniques, including colony
morphological evaluation, Gram staining, and biochemical testing such as catalase and
oxidase test will be used to identify isolated bacterial colonies after incubation (Dhungel
et al., 2021).

9
Antimicrobial Susceptibility Test of Isolated Organisms
The Clinical and Laboratory Standards Institute CLSI (2022) guidelines will be
carefully followed for media preparation, media selection, antibiotic disc implantation, and
measurement of the zone of inhibition. A fresh Muller Hinton agar plate will be used to
carefully transfer bacterial growth from a pure culture plate. Antibiotic discs with specified
concentrations (Table 1) will be precisely put onto the agar surface using sterile forceps.
The plates will next be incubated at 37°C in an aerobic setting (Tasneem et al., 2022).

Table 1. Lists of antibiotics to be used in research

S. No. Antibiotics Abbreviations Concentration
1 Ceftazadime CAZ 30µg
2 Pipracillin/Tazobactum TZP 110µg
3 Cefepime FEP 30µg
4 Meropenem MEM 10µg
5 Imipenem IPM 10µg
6 Azetreonam AZT 30µg
7 Ciprofloxacin CIP 05µg
8 Levofloxacin LEVO 05µg
9 Norfloxacin NOR 10µg
10 Gentamycin GEN 10µg

Multidrug Resistance (MDR) Phenotype Assessment

The isolates that exhibit MDR patterns due to elevated efflux pump expression will
be identified. The specific antibiotics contributing to the MDR phenotype will be
documented (Rahbar et al., 2021).

Phenotypic Test of Efflux Pump Expression

Efflux pump activity will be determined by the ethidium bromide cartwheel method
phenotypically. Tryptic Soy agar plates will be prepared at different concentrations (0.0,
0.5, 1.0, 1.5, 2.0 and 2.5mg/L) of ethidium bromide (EtBr) and the microorganisms will be
inoculated on the plates according the cartwheel method as shown in Figure 1 (Altınöz &
Altuner, 2022).

10
Figure 1. Cartwheel method for confirmation of efflux pump expression

Petri dishes will be incubated at 37oC and after incubation the Tryptic Soy agar
plates containing EtBr will be observed under UV light (Altınöz & Altuner, 2022).

Efflux Pump Expression Analysis

Bacterial DNA will be extracted from the isolates. The expression of efflux pumps
genes (MexAB-OprM) using molecular techniques such as RT-qPCR will be quantified
(Amsalu et al., 2020).

11
DNA Extraction and PCR Amplification
The DNA of bacteria will be isolated from a streaked plate that had been incubated
overnight. A sterile pipette tip will be used to collect the growth, and 100µL of nuclease-
free water will be used for suspension, then vigorously mixed to make a turbid solution. In
the following steps, a thermal shock at 120°C will be applied to the tube for 40 minutes,
followed by 3-4 minutes of spinning until a pellet is formed. Following this, a sterile
Eppendorf tube will hold the supernatant containing bacterial chromosomal and plasmid
DNA, while the pellet will be discarded. In order to verify template DNA in the supernatant,
0.8% ethidium bromide stained gels will be used. Samples will be stored in the freezer until
needed. The PCR master mix and conditions will be used for resistance genes, the primers
will be obtained from Macrogen, Korea (table 2). The reaction mixture will be completely
mixed using a micro centrifuge. PCR amplification will be carried out with a thermal cycler
followed by PCR amplification. Finally Gel electrophoresis will be performed (Tasneem
et al., 2022).

Table 2. Primers Sequences and amplicon size

S. No. Gene Name Primer Sequence Size (bp) Reference

1 MexA F:5′CAGGCCGTGAGCAAGCAG3′ 100 Aghazadeh et al.,

R:5′CCTTGGTGTAGCGCAGGTTG3′ 2014

2 MexB F: 5′ GTGTTCGGCTCGCAGTACTC3′ 244 Shigemura et al.,

R: 5′ AACCGTCGGGATTGACCTTG3′ 2015

Statistical Analysis
The data will be interpreted using a Microsoft Excel spreadsheet and after that, it
will be analyzed through the SPSS v. 26.0 and Chi-square test will be used for association,
odd ratio to determine statistical significance for age, gender, and antibiotic susceptibility
patterns (Dhungel et al., 2021).

12
 Time Frame

The time duration is mentioned in the below

Activity Duration
S. No.

1 Collection and processing of samples and Identification 3 Month

following schedule.

2 Molecular Characterization, Data analysis, and interpretation 2 Month

3 Thesis write-up 1 Months

13
 VI. REFERENCES

Abushaheen, M. A., Fatani, A. J., Alosaimi, M., Mansy, W., George, M., Acharya, S. &
Jhugroo, P. (2020). Antimicrobial resistance, mechanisms and its clinical
significance. Disease-a-Month, 66(6), 100971. Dreier, J., & Ruggerone, P.
(2015). Interaction of antibacterial compounds with RND efflux pumps in
Pseudomonas aeruginosa. Frontiers in microbiology, 6, 660.
Aghazadeh, M., Hojabri, Z., Mahdian, R., Nahaei, M. R., Rahmati, M., Hojabri, T. &
Pajand, O. (2014). Role of efflux pumps: MexAB-OprM and MexXY (-OprA),
AmpC cephalosporinase and OprD porin in non-metallo-β-lactamase
producing Pseudomonas aeruginosa isolated from cystic fibrosis and burn
patients. Infection, Genetics and Evolution, 24, 187-192.
Altınöz, E., & Altuner, E. M. (2022). Observing the presence of efflux pump activities in
some clinically isolated bacterial strains. International Journal of Biology and
Chemistry, 15(1), 48-54.
Amsalu, A., Sapula, S. A., De Barros Lopes, M., Hart, B. J., Nguyen, A. H., Drigo, B., ...
& Venter, H. (2020). Efflux pump-driven antibiotic and biocide cross-
resistance in Pseudomonas aeruginosa isolated from different ecological
niches: a case study in the development of multidrug resistance in
environmental hotspots. Microorganisms, 8(11), 1647.
Beig, M., & Arabestani, M. R. (2019). Investigation of MexAB-OprM efflux pump gene
expression in clinical isolates of Pseudomonas aeruginosa isolated from
Intensive Care Unit. Iranian Journal of Medical Microbiology, 13(2), 142-150.
Botelho, J., Grosso, F., & Peixe, L. (2019). Antibiotic resistance in Pseudomonas
aeruginosa–Mechanisms, epidemiology and evolution. Drug resistance
updates, 44, 100640.
Breidenstein, E. B., de la Fuente-Núñez, C., & Hancock, R. E. (2011). Pseudomonas
aeruginosa: all roads lead to resistance. Trends in microbiology, 19(8), 419-
426.
Chuanchuen, R., Beinlich, K., Hoang, T. T., Becher, A., Karkhoff-Schweizer, R. R., &
Schweizer, H. P. (2001). Cross-resistance between triclosan and antibiotics in

14
 Pseudomonas aeruginosa is mediated by multidrug efflux pumps: exposure of
a susceptible mutant strain to triclosan selects nfxB mutants overexpressing
MexCD-OprJ. Antimicrobial agents and chemotherapy, 45(2), 428-432.
Colclough, A. L., Alav, I., Whittle, E. E., Pugh, H. L., Darby, E. M., Legood, S. W. & Blair,
J. M. (2020). RND efflux pumps in Gram-negative bacteria; regulation,
structure and role in antibiotic resistance. Future microbiology, 15(2), 143-157.
Dhungel, S., Rijal, K. R., Yadav, B., Dhungel, B., Adhikari, N., Shrestha, U. T. & Ghimire,
P. (2021). Methicillin-Resistant Staphylococcus aureus (MRSA): Prevalence,
antimicrobial susceptibility pattern, and detection of mecA gene among cardiac
patients from a tertiary care heart center in Kathmandu, Nepal. Infectious
Diseases: Research and Treatment, 14, 11786337211037355.
Diggle, S. P., & Whiteley, M. (2020). Microbe Profile: Pseudomonas aeruginosa:
opportunistic pathogen and lab rat. Microbiology, 166(1), 30.
Forbes, B. A., Sahm, D. F., & Weissfeld, A. S. (2007). Diagnostic microbiology (pp. 288-
302). St Louis: Mosby.
Gopal, M. A., & Thirupathi, A. Isolation and Identification of Pseudomonas aeruginosa
From Uropathogens. European Journal of Molecular & Clinical
Medicine, 7(11), 2020.
Jeannot, K., Elsen, S., Köhler, T., Attree, I., van Delden, C., & Plésiat, P. (2008).
Resistance and virulence of Pseudomonas aeruginosa clinical strains
overproducing the MexCD-OprJ efflux pump. Antimicrobial agents and
chemotherapy, 52(7), 2455-2462.
Leylabadlo, H. E., Pourlak, T., Aghazadeh, M., Asgharzadeh, M., & Kafil, H. S. (2017).
Extended-spectrum beta-lactamase producing gram negative bacteria In Iran:
A review. African journal of infectious diseases, 11(2), 39-53.
Puzari, M., & Chetia, P. (2017). RND efflux pump mediated antibiotic resistance in Gram-
negative bacteria Escherichia coli and Pseudomonas aeruginosa: a major issue
worldwide. World Journal of Microbiology and Biotechnology, 33, 1-8.
Pesingi, P. V., Singh, B. R., Pesingi, P. K., Bhardwaj, M., Singh, S. V., Kumawat, M.,
Sinha, D. K., & Gandham, R. K. (2019). MexAB-OprM Efflux Pump
of Pseudomonas aeruginosa Offers Resistance to Carvacrol: A Herbal

15
 Antimicrobial Agent. Frontiers in microbiology, 10, 2664.
https://doi.org/10.3389/fmicb.2019.02664
Rahbar, M., Hamidi-Farahani, R., Asgari, A., Esmailkhani, A., & Soleiman-Meigooni, S.
(2021). Expression of RND efflux pumps mediated antibiotic resistance in
Pseudomonas aeruginosa clinical strains. Microbial Pathogenesis, 153,
104789.
Roy Chowdhury, P., Scott, M. J., & Djordjevic, S. P. (2017). Genomic islands 1 and 2
carry multiple antibiotic resistance genes in Pseudomonas aeruginosa ST235,
ST253, ST111 and ST175 and are globally dispersed. Journal of Antimicrobial
Chemotherapy, 72(2), 620-622.
Reineke, W., & Schlömann, M. (2023). Microorganisms at Different Sites: Living
Conditions and Adaptation Strategies. In Environmental Microbiology (pp.
349-396). Berlin, Heidelberg: Springer Berlin Heidelberg.
Shigemura, K., Osawa, K., Kato, A., Tokimatsu, I., Arakawa, S., Shirakawa, T., &
Fujisawa, M. (2015). Association of overexpression of efflux pump genes with
antibiotic resistance in Pseudomonas aeruginosa strains clinically isolated
from urinary tract infection patients. The Journal of antibiotics, 68(9), 568-572.
Su, S. S., Lae, K. Z. W., & Ngwe, H. (2018). Isolation and Identification of Pseudomonas
aeruginosa from the Clinical Soil. Univer;sity of Yangon Res J, 8, 271-275.
Tag ElDein, M. A., Yassin, A. S., El-Tayeb, O., & Kashef, M. T. (2021). Chlorhexidine
leads to the evolution of antibiotic-resistant Pseudomonas
aeruginosa. European Journal of Clinical Microbiology & Infectious
Diseases, 40(11), 2349-2361.
Tasneem, U., Majid, M., Mehmood, K., Rehman, F. U., Andleeb, S., & Jamal, M. (2022).
Co-occurrence of antibiotic resistance and virulence Genes in Methicillin
Resistant Staphylococcus aureus (MRSA) Isolates from Pakistan. African
Health Sciences, 22(1), 486-95.
Terzi, H. A., Kulah, C., & Ciftci, I. H. (2014). The effects of active efflux pumps on
antibiotic resistance in Pseudomonas aeruginosa. World Journal of
Microbiology and Biotechnology, 30, 2681-2687.

16
Theel, E. S., & Ross, T. (2019). Seasonality of Bartonella henselae IgM and IgG antibody
positivity rates. Journal of Clinical Microbiology, 57(12), e01263-19.
Valot, B., Guyeux, C., Rolland, J. Y., Mazouzi, K., Bertrand, X., & Hocquet, D. (2015).
What it takes to be a Pseudomonas aeruginosa? The core genome of the
opportunistic pathogen updated. PloS one, 10(5), e0126468.
Willyard, C. (2017). Drug-resistant bacteria ranked. Nature, 543(7643), 15.

17