Its all about data mining

A Brief Presentation on Data Mining
Jason Rodrigues
Data Mining

• Introduction
• What is Data Mining?
• Challenges and Trends
• The origin of DM
• Data Mining Tasks
• Types of Data
• Data Quality
• Takeaways
Agenda

What is Data Mining?
Definition:

Data mining is the process of extracting patterns from
data.- Wikipedia

Process of semi-automatically analyzing large databases
to find patterns that are:

valid: hold on new data with some certainty

novel: non-obvious to the system

useful: should be possible to act on the item

understandable: humans should be able to interpret the pattern
Other Definitions:

Non-trivial extraction of implicit, previously unknown and
potentially useful information from data

Exploration & analysis, by automatic or
semi-automatic means, of
large quantities of data
in order to discover
meaningful patterns

What is Data Mining? (Other Definitions)

Extracting or “mining” knowledge from large amounts of
data

Data -driven discovery and modeling of hidden patterns
(we never new existed) in large volumes of data

Extraction of implicit, previously unknown and
unexpected, potentially extremely useful information
from data

– Certain names are more
prevalent in certain US
locations (O’Brien, O’Rurke,
O’Reilly… in Boston area)
– Group together similar
documents returned by
search engine according to
their context (e.g. Amazon
rainforest, Amazon.com,)
What is not Data
Mining?
– Look up phone
number in phone
directory
– Query a Web
search engine for
information about
“Amazon”

Moore's Law:

The law is named after Intel co-founder Gordon E. Moore, who described the
trend in his 1965 paper. The paper noted that number of components in
integrated circuits had doubled every year from the invention of the integrated
circuit in 1958 until 1965 and predicted that the trend would continue "for at least
ten years"

The number of transistors that can be placed inexpensively on an integrated
circuit has doubled approximately every two years. The trend has continued for
more than half a century and is not expected to stop until 2015 or later.

Moore's Law:

What is Data Mining? History

Data Analysis?

Data Warehouse?

Data Mining and Statistics
− Standard Deviation

Data Mining and AI and Machine Learning
− Identify Possible Heart Attack cases
1980's1980's
1990's1990's
2000's2000's
2010's2010's

Data Mining Challenges and Trends

Commercial Viewpoint


Scientific Viewpoint

 Computationally expensive to investigate all
possibilities
 Dealing with noise/missing information and
errors in data
 Choosing appropriate attributes/input
representation
 Finding the minimal attribute space
 Finding adequate evaluation function(s)
 Extracting meaningful information
 Not overfitting

Predictive AnalysisPredictive Analysis
Presentation Exploration Discovery
Passive
Interactive
Proactive
Role of Software
Business
Insight
Canned reporting
Ad-hoc reporting
Online Analytical
Processing
Data mining

Data Mining Tasks

Prediction Methods
− Use some variables to predict unknown or
future values of other variables.

Description Methods
− Find human-interpretable patterns that
describe the data.

Data Mining Tasks

Classification [Predictive]

Clustering [Descriptive]

Association Rule Discovery [Descriptive]

Sequential Pattern Discovery [Descriptive]

Regression [Predictive]

Deviation Detection [Predictive]

Data Mining Tasks
 Concept/Class description: Characterization
and discrimination
 Generalize, summarize, and contrast data
characteristics, e.g., dry vs. wet regions
 Association (correlation and causality)
 Multi-dimensional or single-dimensional association
age(X, “20-29”) ^ income(X, “60-90K”)  buys(X, “TV”)

Data Mining Tasks
 Classification and Prediction
 Finding models (functions) that describe and
distinguish classes or concepts for future prediction
 Example: classify countries based on climate, or
classify cars based on gas mileage
 Presentation:
 If-THEN rules, decision-tree, classification rule,
neural network
 Prediction: Predict some unknown or missing
numerical values

Data Mining Tasks

Cluster analysis
− Class label is unknown: Group data to form
new classes,

Example: cluster houses to find distribution
patterns
− Clustering based on the principle:
maximizing the intra-class similarity and
minimizing the interclass similarity

Data Mining Tasks
 Outlier analysis
 Outlier: a data object that does not comply with the
general behavior of the data
 Mostly considered as noise or exception, but is
quite useful in fraud detection, rare events analysis
 Trend and evolution analysis
 Trend and deviation: regression analysis
 Sequential pattern mining, periodicity analysis

Takeaways
Challenges and Trends
The origin of DM
Data Mining Tasks

What is Data?

Collection of data objects and
their attributes

An attribute is a property or
characteristic of an object
− Examples: eye color of a
person, temperature, etc.
− Attribute is also known as
variable, field, characteristic,
or feature

A collection of attributes
describe an object
− Object is also known as
record, point, case, sample,
entity, or instance
Tid Refund Marital
Status
Taxable
Income Cheat
1 Yes Single 125K No
2 No Married 100K No
3 No Single 70K No
4 Yes Married 120K No
5 No Divorced 95K Yes
6 No Married 60K No
7 Yes Divorced 220K No
8 No Single 85K Yes
9 No Married 75K No
10 No Single 90K Yes
10
Attributes
Objects

Attribute Values

Attribute values are numbers or symbols assigned to an
attribute

Distinction between attributes and attribute values
− Same attribute can be mapped to different attribute values

Example: height can be measured in feet or meters
− Different attributes can be mapped to the same set of
values

Example: Attribute values for ID and age are integers

But properties of attribute values can be different
− ID has no limit but age has a maximum and
minimum value

Types of Attribute

There are different types of attributes
– Nominal
 Examples: ID numbers, eye color, zip codes
– Ordinal
 Examples: rankings (e.g., taste of potato chips on
a scale from 1-10), grades, height in {tall, medium,
short}
– Interval
 Examples: calendar dates, temperatures in Celsius
or Fahrenheit.
– Ratio
 Examples: temperature in Kelvin, length, time,
counts

Properties of Attribute Values

The type of an attribute depends on which of
the following properties it possesses:
− Distinctness: = ≠
− Order: < >
− Addition: + -
− Multiplication: * /
− Nominal attribute: distinctness
− Ordinal attribute: distinctness & order
− Interval attribute: distinctness, order & addition
− Ratio attribute: all 4 properties

Attribute
Type
Description Examples Operations
Nominal The values of a nominal attribute
are just different names, i.e.,
nominal attributes provide only
enough information to distinguish
one object from another. (=, ≠)
zip codes, employee
ID numbers, eye
color, sex: {male,
female}
mode, entropy,
contingency
correlation, χ2
test
Ordinal The values of an ordinal attribute
provide enough information to
order objects. (<, >)
hardness of
minerals, {good,
better, best},
grades, street
numbers
median,
percentiles, rank
correlation, run
tests, sign tests
Interval For interval attributes, the
differences between values are
meaningful, i.e., a unit of
measurement exists.
(+, - )
calendar dates,
temperature in
Celsius or
Fahrenheit
mean, standard
deviation,
Pearson's
correlation, t and
F tests
Ratio For ratio variables, both
differences and ratios are
meaningful. (*, /)
temperature in
Kelvin, monetary
quantities, counts,
age, mass, length,
electrical current
geometric mean,
harmonic mean,
percent variation

Discreet and Continuous Attributes

Discrete Attribute
− Has only a finite or countably infinite set of values
− Examples: zip codes, counts, or the set of words in a collection
of documents
− Often represented as integer variables.
− Note: binary attributes are a special case of discrete attributes

Continuous Attribute
− Has real numbers as attribute values
− Examples: temperature, height, or weight.
− Practically, real values can only be measured and represented
using a finite number of digits.
− Continuous attributes are typically represented as floating-point
variables.

Types of Record Sets
Record
− Data Matrix
− Document Data
− Transaction Data
Graph
− World Wide Web
− Molecular Structures
Ordered
− Spatial Data
− Temporal Data
− Sequential Data
− Genetic Sequence Data

Record Sets

Data that consists of a collection of
records, each of which consists of a fixed
set of attributes
Tid Refund Marital
Status
Taxable
Income Cheat
1 Yes Single 125K No
2 No Married 100K No
3 No Single 70K No
4 Yes Married 120K No
5 No Divorced 95K Yes
6 No Married 60K No
7 Yes Divorced 220K No
8 No Single 85K Yes
9 No Married 75K No
10 No Single 90K Yes
10

Data Matrics

If data objects have the same fixed set of numeric
attributes, then the data objects can be thought of as
points in a multi-dimensional space, where each
dimension represents a distinct attribute

Such data set can be represented by an m by n matrix,
where there are m rows, one for each object, and n
columns, one for each attribute

Document Data

Each document becomes a `term' vector,
− each term is a component (attribute) of the
vector,
− the value of each component is the number of
times the corresponding term occurs in the
document.

Transaction Data

A special type of record data, where
− each record (transaction) involves a set of
items.
− For example, consider a grocery store. The
set of products purchased by a customer
during one shopping trip constitute a
transaction, while the individual products that
were purchased are the items.
TID Items
1 Bread, Coke, Milk
2 Beer, Bread
3 Beer, Coke, Diaper, Milk
4 Beer, Bread, Diaper, Milk
5 Coke, Diaper, Milk

Graph Data

A Generic Graph
5
2
1
2
5

Chemical Data
 Benzene Molecule: C6H6

Ordered Data

Sequences of transactions
An element of
the sequence
Items/Events

Ordered Data

Genomic Sequences
GGTTCCGCCTTCAGCCCCGCGCC
CGCAGGGCCCGCCCCGCGCCGTC
GAGAAGGGCCCGCCTGGCGGGCG
GGGGGAGGCGGGGCCGCCCGAGC
CCAACCGAGTCCGACCAGGTGCC
CCCTCTGCTCGGCCTAGACCTGA
GCTCATTAGGCGGCAGCGGACAG
GCCAAGTAGAACACGCGAAGCGC
TGGGCTGCCTGCTGCGACCAGGG

Ordered Data

Spacio Temporal Data
Average Monthly
Temperature of
land and ocean

Data Quality

What kinds of data quality problems?

How can we detect problems with the
data?

What can we do about these problems?

Examples of data quality problems:
− Noise and outliers
− missing values
− duplicate data

Noise

Noise refers to modification of original
values
− Examples: distortion of a person’s voice when
talking on a poor phone and “snow” on
television screen
Two Sine Waves Two Sine Waves + Noise

Outliers

Outliers are data objects with
characteristics that are considerably
different than most of the other data
objects in the data set

Missing Values

Reasons for missing values
− Information is not collected
(e.g., people decline to give their age and
weight)
− Attributes may not be applicable to all cases
(e.g., annual income is not applicable to
children)

Handling missing values
− Eliminate Data Objects
− Estimate Missing Values
− Ignore the Missing Value During Analysis
− Replace with all possible values (weighted by
their probabilities)

Duplicate Data

Data set may include data objects that are
duplicates, or almost duplicates of one
another
− Major issue when merging data from
heterogeous sources

Examples:
− Same person with multiple email addresses

Data cleaning
− Process of dealing with duplicate data issues

Six Rules of Data Quality
1. Data that is not used cannot be correct for very long
2. Data Quality in an information system is a function of
its use, not its collection
3.Data quality will ultimately be no better than its most
stringent use
4. Data quality problems tend to become worse with
the age of the system
5. Less likely it is that some data element will change,
more traumatic it will be when it finally does change.
6. Information overload affects data quality

Takeaways
Challenges and Trends
The origin of DM
Data Mining Tasks
Data Types
Data Quality

Its all about data mining

More Related Content

What's hot (16)

Similar to Its all about data mining (20)

More from Jason Rodrigues (9)

Recently uploaded (20)

Its all about data mining