Transcription of DNA to RNA

Transcription of DNA to RNA

• 1.
  Transcription of DNAto RNA
• 2.
  How does RNAdiffer from DNA? DNA RNA • Deoxyribonucleic acid • Double helix • Ribonucleic acid • Single strand • Makes proteins Both have different nucleotides! Both have different nucleotides!
• 3.
  Differences in Nucleotides RNANucleotides DNA Nucleotides • Guanine • Cytosine • Adenine • Uracil • Guanine • Cytosine • Adenine • Thymine G T A C G U A C RNADNA
• 5.
  What is transcription? •Transcription is the name given to the process where the information in a gene in a DNA strand is transferred to an RNA molecule.
• 6.
  Transfer RNA Messenger RNA(mRNA) Ribosome RNA
• 7.
  Transfer RNA • Transfersspecific amino acids to growing polypeptide chains at the ribosomal site of protein synthesis during translation.
• 8.
  Messenger RNA (mRNA) •The form of RNA that mediates the transfer of genetic information from the cell nucleus to ribosomes in the cytoplasm, where it serves as a template for protein synthesis.
• 9.
  Ribosomal RNA • It’sa component of the ribosome, and is essential for protein synthesis in all living organisms.
• 10.
  RNA Polymerase Bindsto DNA Elongation Termination
• 11.
  RNA Polymerase Bindsto DNA • DNA is transcribed by an enzyme called RNA polymerase. Specific nucleotide sequences tell RNA polymerase where to begin and where to end. RNA polymerase attaches to the DNA at a specific area called the promoter region.
• 12.
  Elongation • Certain proteinscalled transcription factors unwind the DNA strand and allow RNA polymerase to transcribe only a single strand of DNA into a single stranded RNA polymer called messenger RNA (mRNA). • The strand that serves as the template is called the antisense strand. The strand that is not transcribed is called the sense strand.
• 13.
  Termination • RNA polymerasemoves along the DNA until it reaches a terminator sequence. At that point, RNA polymerase releases the mRNA polymer and detaches from the DNA. • The new mRNA is released from the RNA polymerase and ready to be used in the traslation protein.
• 14.
  http://www.youtube.com/watch?v=5MfSYnItYvg
• 15.
  SUMMARY • RNA iscreated from DNA template • RNA polymerase bonds to the promoter site of a DNA strand in order to begin DNA transcription • It conbines with transcription factors to form the transcription iniciation complex • RNA polymerase moves thru DNA and breaks hidrogen bonds • Only one strand of DNA is copied in the process of transcription • RNA nucleotides pair with complementary DNA nucleotides in order to form a RNA strand (its known as mRNA; its the copy of the message contained in the gene) • Ends when the RNA polymerase reaches the termination site of the DNA, the DNA strands unite again and the RNA moves away. • The new mRNA is released from the RNA polymerase and ready to be used in the traslation protein.
• 16.
  Activity DNA-RNA • ACTGGATCAAGTAGGATCATGAA •TACGGATCGTTATTCGATAGTTCA • TTTCGGATGGTCTAGGATAGTACG