| 3b82b91b |
Note that RStudio users will need to add the following line to their `.Rprofile`
file in order for `crisprScore` to work properly:
```{r, eval=FALSE}
options(reticulate.useImportHook=FALSE)
```
# Getting started
We load `crisprScore` in the usual way:
```{r, warnings=FALSE, message=FALSE}
library(crisprScore)
```
The `scoringMethodsInfo` data.frame contains a succinct summary of scoring
methods available in `crisprScore`:
```{r}
data(scoringMethodsInfo)
print(scoringMethodsInfo)
```
Each scoring algorithm requires a different contextual nucleotide sequence.
The `left` and `right` columns indicates how many nucleotides upstream
and downstream of the first nucleotide of the PAM sequence are needed for
input, and the `len` column indicates the total number of nucleotides needed
for input. The `crisprDesign` [(GitHub link)](https://github.com/Jfortin1/crisprDesign)
package provides user-friendly functionalities to extract and score those
sequences automatically via the `addOnTargetScores` function.
# On-targeting efficiency scores
Predicting on-target cutting efficiency is an extensive area of research, and
we try to provide in `crisprScore` the latest state-of-the-art algorithms as
they become available.
## Cas9 methods
Different algorithms require different input nucleotide
sequences to predict cutting efficiency as illustrated in the figure below.
```{r, echo=FALSE,fig.cap="Sequence inputs for Cas9 scoring methods"}
knitr::include_graphics("vignettes/figures/sequences_cas9.svg")
```
### Rule Set 1
The Rule Set 1 algorithm is one of the first on-target efficiency methods
developed for the Cas9 nuclease [@ruleset1]. It generates a probability
(therefore a score between 0 and 1) that a given sgRNA will cut at its
intended target. 4 nucleotides upstream and 3 nucleotides downstream of
the PAM sequence are needed for scoring:
```{r, eval=TRUE}
flank5 <- "ACCT" #4bp
spacer <- "ATCGATGCTGATGCTAGATA" #20bp
pam <- "AGG" #3bp
flank3 <- "TTG" #3bp
input <- paste0(flank5, spacer, pam, flank3)
results <- getRuleSet1Scores(input)
```
The Azimuth score described below is an improvement over Rule Set 1
from the same lab.
### Azimuth
The Azimuth algorithm is an improved version of the popular Rule Set 2 score for
the Cas9 nuclease [@azimuth]. It generates a probability (therefore a score
between 0 and 1) that a given sgRNA will cut at its intended target.
4 nucleotides upstream and 3 nucleotides downstream of the PAM
sequence are needed for scoring:
```{r, eval=FALSE}
flank5 <- "ACCT" #4bp
spacer <- "ATCGATGCTGATGCTAGATA" #20bp
pam <- "AGG" #3bp
flank3 <- "TTG" #3bp
input <- paste0(flank5, spacer, pam, flank3)
results <- getAzimuthScores(input)
```
### Rule Set 3
The Rule Set 3 is an improvement over Rule Set 1 and Rule Set 2/Azimuth
developed for the SpCas9 nuclease, taking into account the type of
tracrRNAs [@ruleset3]. Two types of tracrRNAs are currently offered:
```
GTTTTAGAGCTA-----GAAA-----TAGCAAGTTAAAAT... --> Hsu2013 tracrRNA
GTTTAAGAGCTATGCTGGAAACAGCATAGCAAGTTTAAAT... --> Chen2013 tracrRNA
```
Similar to Rule Set 1 and Azimuth, the input sequence requires 4 nucleotides
upstream of the protospacer sequence, the protospacer sequence itself
(20nt spacersequence and PAM sequence), and 3 nucleotides downstream of
the PAM sequence:
```{r, eval=FALSE}
flank5 <- "ACCT" #4bp
spacer <- "ATCGATGCTGATGCTAGATA" #20bp
pam <- "AGG" #3bp
flank3 <- "TTG" #3bp
input <- paste0(flank5, spacer, pam, flank3)
results <- getRuleSet3Scores(input, tracrRNA="Hsu2013")
```
A more involved version of the algorithm takes into account gene context of
the target protospacer sequence (Rule Set 3 Target) and will be soon
implemented in `crisprScore`.
### DeepHF
The DeepHF algorithm is an on-target cutting efficiency prediction algorithm for
several variants of the Cas9 nuclease [@deepcas9] using a recurrent neural
network (RNN) framework. Similar to the Azimuth score, it generates a
probability of cutting at the intended on-target. The algorithm only needs
the protospacer and PAM sequences as inputs:
```{r, eval=FALSE}
spacer <- "ATCGATGCTGATGCTAGATA" #20bp
pam <- "AGG" #3bp
input <- paste0(spacer, pam)
results <- getDeepHFScores(input)
```
Users can specify for which Cas9 they wish to score sgRNAs by using the argument
`enzyme`: "WT" for Wildtype Cas9 (WT-SpCas9), "HF" for high-fidelity Cas9
(SpCas9-HF), or "ESP" for enhancedCas9 (eSpCas9). For wildtype Cas9, users can
also specify the promoter used for expressing sgRNAs using the argument
`promoter` ("U6" by default). See `?getDeepHFScores` for more details.
### DeepSpCas9
The DeepSpCas9 algorithm is an on-target cutting efficiency prediction
algorithm for the SpCas9 nuclease [@deepspcas9]. Similar to the Azimuth score,
it generates a probability of cutting at the intended on-target.
4 nucleotides upstream of the protospacer sequence, and 3 nucleotides
downstream of the PAM sequence are needed in top of the protospacer
sequence for scoring:
```{r, eval=FALSE}
flank5 <- "ACCT" #4bp
spacer <- "ATCGATGCTGATGCTAGATA" #20bp
pam <- "AGG" #3bp
flank3 <- "TTG" #3bp
input <- paste0(flank5, spacer, pam, flank3)
results <- getDeepSpCas9Scores(input)
```
```{r, eval=FALSE}
spacer <- "ATCGATGCTGATGCTAGATA" #20bp
pam <- "AGG" #3bp
input <- paste0(spacer, pam)
results <- getDeepHFScores(input)
```
Users can specify for which Cas9 they wish to score sgRNAs by using the argument
`enzyme`: "WT" for Wildtype Cas9 (WT-SpCas9), "HF" for high-fidelity Cas9
(SpCas9-HF), or "ESP" for enhancedCas9 (eSpCas9). For wildtype Cas9, users can
also specify the promoter used for expressing sgRNAs using the argument
`promoter` ("U6" by default). See `?getDeepHFScores` for more details.
### CRISPRscan
The CRISPRscan algorithm, also known as the Moreno-Mateos score, is an
on-target efficiency method for the SpCas9 nuclease developed for sgRNAs
expressed from a T7 promoter, and trained on zebrafish data [@crisprscan].
It generates a probability (therefore a score between 0 and 1) that a given
sgRNA will cut at its intended target.
6 nucleotides upstream of the protospacer sequence
and 6 nucleotides downstream of the PAM sequence are needed for scoring:
```{r, eval=TRUE}
flank5 <- "ACCTAA" #6bp
spacer <- "ATCGATGCTGATGCTAGATA" #20bp
pam <- "AGG" #3bp
flank3 <- "TTGAAT" #6bp
input <- paste0(flank5, spacer, pam, flank3)
results <- getCRISPRscanScores(input)
```
### CRISPRater
The CRISPRater algorithm is an on-target efficiency method for the SpCas9 nuclease [@crisprater].
It generates a probability (therefore a score between 0 and 1) that a given
sgRNA will cut at its intended target.
Only the 20bp spacer sequence is required.
```{r, eval=TRUE}
spacer <- "ATCGATGCTGATGCTAGATA" #20bp
results <- getCRISPRaterScores(spacer)
```
### CRISPRai
The CRISPRai algorithm was developed by the Weissman lab to score SpCas9
gRNAs for CRISPRa and CRISPRi applications [@crisprai], for the human genome.
The function `getCrispraiScores` requires several inputs.
First, it requires a data.frame specifying the genomic coordinates of
the transcription starting sites (TSSs). An example of such a data.frame
is provided in the crisprScore package:
```{r, eval=TRUE}
head(tssExampleCrispri)
```
It also requires a data.frame specifying the genomic coordinates of the
gRNA sequences to score. An example of such a data.frame
is provided in the crisprScore package:
```{r, eval=TRUE}
head(sgrnaExampleCrispri)
```
All columns present in `tssExampleCrispri` and `sgrnaExampleCrispri` are
mandatory for `getCrispraiScores` to work.
Two additional arguments are required: `fastaFile`, to specify the path of
the fasta file of the human reference genome, and `chromatinFiles`, which is
a list of length 3 specifying the path of files containing the chromatin
accessibility data needed for the algorithm in hg38 coordinates.
The chromatin files can be downloaded from Zenodo
[here](https://zenodo.org/record/6716721#.YrzCfS-cY4d).
The fasta file for the human genome (hg38) can be downloaded directly from here:
https://hgdownload.soe.ucsc.edu/goldenPath/hg38/bigZips/hg38.fa.gz
One can obtain the CRISPRai scores using the following command:
```{r, eval=FALSE}
results <- getCrispraiScores(tss_df=tssExampleCrispri,
sgrna_df=sgrnaExampleCrispri,
modality="CRISPRi",
fastaFile="your/path/hg38.fa",
chromatinFiles=list(mnase="path/to/mnaseFile.bw",
dnase="path/to/dnaseFile.bw",
faire="oath/to/faireFile.bw"))
```
The function works identically for CRISPRa applications, with modality replaced
by `CRISPRa`.
## Cas12a methods
Different algorithms require different input nucleotide
sequences to predict cutting efficiency as illustrated in the figure below.
```{r, echo=FALSE, fig.cap="Sequence inputs for Cas12a scoring methods"}
knitr::include_graphics("vignettes/figures/sequences_cas12a.svg")
```
### DeepCpf1 score
The DeepCpf1 algorithm is an on-target cutting efficiency prediction algorithm
for the Cas12a nuclease [@deepcpf1] using a convolutional neural network (CNN)
framework. It generates a score between 0 and 1 to quantify the likelihood of
Cas12a to cut for a given sgRNA. 3 nucleotides upstream and 4 nucleotides
downstream of the PAM sequence are needed for scoring:
```{r, eval=FALSE}
flank5 <- "ACC" #3bp
pam <- "TTTT" #4bp
spacer <- "AATCGATGCTGATGCTAGATATT" #23bp
flank3 <- "AAGT" #4bp
input <- paste0(flank5, pam, spacer, flank3)
results <- getDeepCpf1Scores(input)
```
### enPAM+GB score
The enPAM+GB algorithm is an on-target cutting efficiency prediction algorithm
for the enhanced Cas12a (enCas12a) nuclease [@enpamgb] using a gradient-booster
(GB) model. The enCas12a nuclease as an extended set of active PAM sequences in
comparison to the wildtype Cas12 nuclease [@encas12a], and the enPAM+GB
algorithm takes PAM activity into account in the calculation of the final score.
It generates a probability (therefore a score between 0 and 1) of a given sgRNA
to cut at the intended target. 3 nucleotides upstream of the PAM sequence and 4 nucleotides downstream of the protospacer sequence are needed for scoring:
```{r, eval=FALSE}
flank5 <- "ACC" #3bp
pam <- "TTTT" #4bp
spacer <- "AATCGATGCTGATGCTAGATATT" #23bp
flank3 <- "AAGT" #4bp
input <- paste0(flank5, pam, spacer, flank3)
results <- getEnPAMGBScores(input)
```
## Cas13d methods
### CasRxRF
The CasRxRF method was developed to characterize on-target efficiency of the RNA-targeting nuclease RfxCas13d, abbreviated as CasRx [@casrxrf].
It requires as an input the mRNA sequence targeted by the gRNAs, and returns as an output on-target efficiency scores for all gRNAs targeting the mRNA sequence.
As an example, we predict on-target efficiency for gRNAs targeting the mRNA sequence stored in the file `test.fa`:
```{r, eval=FALSE}
fasta <- file.path(system.file(package="crisprScore"),
"casrxrf/test.fa")
mrnaSequence <- Biostrings::readDNAStringSet(filepath=fasta
format="fasta",
use.names=TRUE)
results <- getCasRxRFScores(mrnaSequence)
```
|
| 3b82b91b |
# Off-target specificity scores
For CRISPR knockout systems, off-targeting effects can occur when the CRISPR
nuclease tolerates some levels of imperfect complementarity between gRNA spacer
sequences and protospacer sequences of the targeted genome. Generally, a greater
number of mismatches between spacer and protospacer sequences decreases the
likelihood of cleavage by a nuclease, but the nature of the nucleotide
substitution can module the likelihood as well. Several off-target specificity
scores were developed to predict the likelihood of a nuclease to cut at an
unintended off-target site given a position-specific set of nucleotide
mismatches.
We provide in `crisprScore` two popular off-target specificity scoring
methods for CRISPR/Cas9 knockout systems: the MIT score [@mit] and the
cutting frequency determination (CFD) score [@azimuth].
## MIT score
The MIT score was an early off-target specificity prediction algorithm developed
for the CRISPR/Cas9 system [@mit]. It predicts the likelihood that the Cas9
nuclease will cut at an off-target site using position-specific mismatch
tolerance weights. It also takes into consideration the total number of
mismatches, as well as the average distance between mismatches.
However, it does not take into account the nature of the nucleotide
substitutions. The exact formula used to estimate the cutting likelihood is
$$\text{MIT} = \biggl(\prod_{p \in
M}{w_p}\biggr)\times\frac{1}{\frac{19-d}{19}\times4+1}\times\frac{1}{m^2}$$
where $M$ is the set of positions for which there is a mismatch between the
sgRNA spacer sequence and the off-target sequence, $w_p$ is an
experimentally-derived mismatch tolerance weight at position $p$, $d$ is the
average distance between mismatches, and $m$ is the total number
of mismatches. As the number of mismatches increases, the cutting
likelihood decreases. In addition, off-targets with more adjacent mismatches
will have a lower cutting likelihood.
The `getMITScores` function takes as argument a character vector of 20bp
sequences specifying the spacer sequences of sgRNAs (`spacers` argument), as
well as a vector of 20bp sequences representing the protospacer sequences of the putative off-targets in the targeted
genome (`protospacers` argument). PAM sequences (`pams`) must also be provided. If only one spacer sequence is provided,
it will reused for all provided protospacers.
The following code will generate MIT scores for 3 off-targets with respect to
the sgRNA `ATCGATGCTGATGCTAGATA`:
```{r}
spacer <- "ATCGATGCTGATGCTAGATA"
protospacers <- c("ACCGATGCTGATGCTAGATA",
"ATCGATGCTGATGCTAGATT",
"ATCGATGCTGATGCTAGATA")
pams <- c("AGG", "AGG", "AGA")
getMITScores(spacers=spacer,
protospacers=protospacers,
pams=pams)
```
## CFD score
The CFD off-target specificity prediction algorithm was initially developed for
the CRISPR/Cas9 system, and was shown to be superior to the MIT score
[@azimuth]. Unlike the MIT score, position-specific mismatch weights vary
according to the nature of the nucleotide substitution (e.g. an A->G mismatch at
position 15 has a different weight than an A->T mismatch at position 15).
Similar to the `getMITScores` function, the `getCFDScores` function takes as
argument a character vector of 20bp sequences specifying the spacer sequences of
sgRNAs (`spacers` argument), as well as a vector of 20bp sequences representing
the protospacer sequences of the putative
off-targets in the targeted genome (`protospacers` argument).
`pams` must also be provided.
If only one spacer
sequence is provided, it will be used for all provided protospacers.
The following code will generate CFD scores for 3 off-targets with respect to
the sgRNA `ATCGATGCTGATGCTAGATA`:
```{r}
spacer <- "ATCGATGCTGATGCTAGATA"
protospacers <- c("ACCGATGCTGATGCTAGATA",
"ATCGATGCTGATGCTAGATT",
"ATCGATGCTGATGCTAGATA")
pams <- c("AGG", "AGG", "AGA")
getCFDScores(spacers=spacer,
protospacers=protospacers,
pams=pams)
```
# Indel prediction score
## Lindel score (Cas9)
Non-homologous end-joining (NHEJ) plays an important role in double-strand break
(DSB) repair of DNA. Error patterns of NHEJ can be strongly biased by sequence
context, and several studies have shown that microhomology can be used to
predict indels resulting from CRISPR/Cas9-mediated cleavage. Among other useful
metrics, the frequency of frameshift-causing indels can be estimated for a given
sgRNA.
Lindel [@lindel] is a logistic regression model that was trained to use local
sequence context to predict the distribution of mutational outcomes.
In `crisprScore`, the function `getLindelScores` return the proportion of
"frameshifting" indels estimated by Lindel. By chance, assuming a random
distribution of indel lengths, frameshifting proportions should be roughly
around 0.66. A Lindel score higher than 0.66 indicates a higher than by chance
probability that a sgRNA induces a frameshift mutation.
The Lindel algorithm requires nucleotide context around the protospacer
sequence; the following full sequence is needed:
[13bp upstream flanking sequence][23bp protospacer sequence]
[29bp downstream flanking sequence], for a total of 65bp.
The function `getLindelScores` takes as inputs such 65bp sequences:
```{r, eval=FALSE}
flank5 <- "ACCTTTTAATCGA" #13bp
spacer <- "TGCTGATGCTAGATATTAAG" #20bp
pam <- "TGG" #3bp
flank3 <- "CTTTTAATCGATGCTGATGCTAGATATTA" #29bp
input <- paste0(flank5, spacer, pam, flank3)
results <- getLindelScores(input)
```
|
