@@ -388,6 +388,22 @@ mrnaSequence <- Biostrings::readDNAStringSet(filepath=fasta

 results <- getCasRxRFScores(mrnaSequence)

 ```

+Note that the function has a default argument `directRepeat` set to `aacccctaccaactggtcggggtttgaaac`, specifying the direct repeat used in the

+CasRx construct (see [@casrxrf].) The function also has an argument `binaries`

+that specifies the file path of the binaries for three 

+programs necessary by the CasRxRF algorithm:

+

+- `RNAfold`: available as part of the ViennaRNA package

+- `RNAplfold`: available as part of the ViennaRNA package

+- `RNAhybrid`: available as part of the RNAhybrid package

+

+Those programs can be installed from their respective websites: [VienneRNA](https://www.tbi.univie.ac.at/RNA/) and [RNAhybrid](https://bibiserv.cebitec.uni-bielefeld.de/rnahybrid/).

+

+If the argument is `NULL`, the binaries are assumed to be available on

+the PATH. 

+

+

+

 # Off-target specificity scores 

@@ -438,6 +438,23 @@ mrnaSequence <- Biostrings::readDNAStringSet(filepath=fasta

 results <- getCasRxRFScores(mrnaSequence)

 ```

+Note that the function has a default argument `directRepeat` set to

+`aacccctaccaactggtcggggtttgaaac`, specifying the direct repeat used in

+the CasRx construct (see (Wessels et al. 2020).) The function also has

+an argument `binaries` that specifies the file path of the binaries for

+three programs necessary by the CasRxRF algorithm:

+

+-   `RNAfold`: available as part of the ViennaRNA package

+-   `RNAplfold`: available as part of the ViennaRNA package

+-   `RNAhybrid`: available as part of the RNAhybrid package

+

+Those programs can be installed from their respective websites:

+[VienneRNA](https://www.tbi.univie.ac.at/RNA/) and

+[RNAhybrid](https://bibiserv.cebitec.uni-bielefeld.de/rnahybrid/).

+

+If the argument is `NULL`, the binaries are assumed to be available on

+the PATH.

+

 # Off-target specificity scores

 For CRISPR knockout systems, off-targeting effects can occur when the

@@ -611,7 +628,7 @@ sessionInfo()

     ## [1] stats     graphics  grDevices utils     datasets  methods   base     

     ## 

     ## other attached packages:

-    ## [1] crisprScore_1.1.6     crisprScoreData_1.1.3 ExperimentHub_2.3.5  

+    ## [1] crisprScore_1.1.9     crisprScoreData_1.1.3 ExperimentHub_2.3.5  

     ## [4] AnnotationHub_3.3.9   BiocFileCache_2.3.4   dbplyr_2.1.1         

     ## [7] BiocGenerics_0.41.2  

     ## 

@@ -624,7 +641,7 @@ sessionInfo()

     ## [11] GenomeInfoDb_1.31.6           stats4_4.2.0                 

     ## [13] RSQLite_2.2.12                evaluate_0.15                

     ## [15] highr_0.9                     httr_1.4.2                   

-    ## [17] pillar_1.7.0                  basilisk_1.9.1               

+    ## [17] pillar_1.7.0                  basilisk_1.9.2               

     ## [19] zlibbioc_1.41.0               rlang_1.0.2                  

     ## [21] curl_4.3.2                    rstudioapi_0.13              

     ## [23] blob_1.2.2                    S4Vectors_0.33.11            

@@ -639,7 +656,7 @@ sessionInfo()

     ## [41] interactiveDisplayBase_1.33.0 IRanges_2.29.1               

     ## [43] randomForest_4.7-1            fansi_1.0.2                  

     ## [45] crayon_1.5.0                  dplyr_1.0.8                  

-    ## [47] later_1.3.0                   basilisk.utils_1.5.0         

+    ## [47] later_1.3.0                   basilisk.utils_1.9.1         

     ## [49] bitops_1.0-7                  rappdirs_0.3.3               

     ## [51] grid_4.2.0                    jsonlite_1.8.0               

     ## [53] xtable_1.8-4                  lifecycle_1.0.1              

@@ -402,6 +402,21 @@ results <- getCasRxRFScores(mrnaSequence)

 ```

+Note that the function has a default argument `directRepeat` set to `aacccctaccaactggtcggggtttgaaac`, specifying the direct repeat used in the

+CasRx construct (see [@casrxrf].) The function also has an argument `binaries`

+that specifies the file path of the binaries for three 

+programs necessary by the CasRxRF algorithm:

+

+- `RNAfold`: available as part of the ViennaRNA package

+- `RNAplfold`: available as part of the ViennaRNA package

+- `RNAhybrid`: available as part of the RNAhybrid package

+

+Those programs can be installed from their respective websites: [VienneRNA](https://www.tbi.univie.ac.at/RNA/) and [RNAhybrid](https://bibiserv.cebitec.uni-bielefeld.de/rnahybrid/).

+

+If the argument is `NULL`, the binaries are assumed to be available on

+the PATH. 

+

+

 # Off-target specificity scores 

 For CRISPR knockout systems, off-targeting effects can occur when the CRISPR